Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Detection kit for citalopram and escitalopram metabolic markers and detection method and application thereof

A technology of metabolic markers and detection kits, which is applied in the field of gene detection, can solve the problems of large individual differences in the efficacy of citalopram, and achieve the effects of improving heat transfer efficiency, temperature consistency, and temperature change speed

Pending Publication Date: 2021-12-21
菲思特(上海)生物科技有限公司
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Clinical application found that the individual differences in the efficacy of citalopram are very large

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection kit for citalopram and escitalopram metabolic markers and detection method and application thereof
  • Detection kit for citalopram and escitalopram metabolic markers and detection method and application thereof
  • Detection kit for citalopram and escitalopram metabolic markers and detection method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Embodiment 1, the preparation of kit

[0045] The kit of the present invention designs specific amplification primers and sequencing primers for CYP2C19 (681G>A) and CYP2C19 (636G>A) for amplification and pyrosequencing detection. Designing primers based on rapid amplification technology is one of the keys of the present invention, and the sequence of gene polymorphism is subject to the public sequence in Genebank.

[0046] (1) The primer sequences of this embodiment are as follows:

[0047] Primer name SEQ ID Sequence (5'~3') modify CYP2C19(681G>A) front primer 1 ACCAGAGCTTGGCATATTGTATC 5`Biotin Primer behind CYP2C19(681G>A) 2 CAAATACGCAAGCAGTCACATAA CYP2C19(636G>A) front primer 3 CTCCCTGCAATGTGATCTGCT Primer behind CYP2C19(636G>A) 4 AAATGTACTTCAGGGCTTGGTC 5`Biotin CYP2C19(681G>A) Sequencing Primers 5 GTAATTTGTTATGGGTTCC CYP2C19(636G>A) Sequencing Primers 6 GGATTGTAAGCACCCC CYP2C19(681G>A) ...

Embodiment 2

[0054] Embodiment 2, pyrophosphate detection

[0055] The instruments adopted in the present invention are as follows: amplification instrument, pyrosequencer (Wuhan First Biotechnology Co., Ltd.).

[0056] (1) Reagent preparation (reagent preparation room)

[0057] Take out the reagents in advance, vortex the PCR reaction solution for 15 seconds, and centrifuge at low speed for later use. . Determine the number of reactions N, N = number of samples to be tested (n) + number of quality control products (1) + blank control. It is recommended to conduct positive control and blank control analysis for each PCR experiment at the same time. Then the reaction solution was dispensed into PCR reaction tubes at 16 μL / tube.

[0058] (2) Sample testing (sample preparation room)

[0059] Add EDTA anticoagulated whole blood, positive control and blank control into the PCR reaction tube according to the sample volume of 4 μL, close the tube cap tightly, centrifuge at low speed for 15 s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
thicknessaaaaaaaaaa
Login to View More

Abstract

The invention discloses a detection kit for citalopram and escitalopram metabolic markers and a detection method and application thereof. The citalopram and escitalopram metabolic markers are CYP2C19, and the kit designs specific amplification primers and sequencing primers for polymorphism of two genes of 681G exceeding A and 636G exceeding A of CYP2C19. The kit comprises the following components: an amplification reaction solution, a CYP2C19 681G exceeding A sequencing primer, a CYP2C19 636G exceeding A sequencing primer and a positive control. The detection kit detects the gene polymorphism related to citalopram and escitalopram dosage guidance by combining blood direct amplification, rapid amplification and optimized pyrosequencing technology, and provides gene-oriented suggestions for clinical personalized medication of citalopram and escitalopram.

Description

technical field [0001] The invention relates to a detection kit for citalopram and escitalopram metabolic markers, a detection method and an application thereof, and belongs to the field of gene detection. Background technique [0002] Escitalopram has been widely used clinically as a first-line drug in recent years for the prevention and treatment of depressive disorders, especially major depression. . Escitalopram is mainly metabolized by CYP2C19 into L-descitalopram (S-DCT) and L-desmethylcitalopram (S-DDCT) in the body, and free escitalopram in plasma is the main activity Element. CYP2C19 mutation can lead to the decrease or loss of CYP2C19 protease function. When patients with slow metabolizers take escitalopram, the blood concentration of escitalopram is significantly higher than that of patients with fast metabolizers, and the drug accumulates in the body, increasing the risk of adverse reactions. It is easy to cause adverse reactions such as QT interval prolongati...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883C12Q1/6858C12N15/11
CPCC12Q1/6883C12Q1/6858C12Q2600/156C12Q2600/106C12Q2600/16C12Q2600/166C12Q2531/113C12Q2535/122C12Q2537/143C12Q2545/113
Inventor 陈立波孙悦刘丹
Owner 菲思特(上海)生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com