Aptamer screening method and application thereof

A screening method and aptamer technology, which is applied in the field of analysis and detection, can solve the problems of inability to cut and destroy the structure of tool enzymes, etc., and achieve the effect of flexible selection and ingenious design

Pending Publication Date: 2021-10-29
HUAQIAO UNIVERSITY
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] On the one hand, the object of the present invention is to solve the problems existing in the existing SELEX technology, and to propose a brand-new aptamer screening method, which replaces the original sequence in the tool enzyme that does not affect the cleavage site with a random sequence, so that the tool enzyme The structure is destroyed and cannot be cleaved, so the library is constructed; after the target molecule is added, the target molecule binds to the random sequence and undergoes a conformational change, allowing the tool enzyme to restore its complete structure and undergo self-cleavage; the cleavage of the tool enzyme is used as a filter screen Conditions, and then enriched through several rounds of screening to obtain aptamers that can bind to target molecules

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Aptamer screening method and application thereof
  • Aptamer screening method and application thereof
  • Aptamer screening method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0042] The specific steps of the RNA aptamer screening method of the present embodiment are as follows:

[0043] ① Construction of DNA library. Stem II of the HHR ribozyme was replaced with N 70 100ng of the replaced HHR sequence is used as a template, and the specific sequence information is:

[0044] SEQ ID No: 01: GGGCGTAGCCTGATGAGN70CGAAACGTGGTGAAAGCC

[0045] As an upstream primer, T 7 Sequence plus the 5' end sequence of HHR ribozyme; as a downstream primer, the sequence complementary to Oligo plus the 3' end sequence of HHR ribozyme, the specific sequence information is:

[0046] Upstream primer (SEQ ID No:02): TAATACGACTCACTATAGGGCGTAGCCTGATGAG

[0047] Downstream primer (SEQ ID No: 03): GGAATCAACCCACAGCTGCGGCGCAGCGACGTGGCTTTCACCACGTTTCG

[0048] When building a library, it needs to reach at least 1×10 15 Quantitative molecular abundance, to ensure the diversity of the screened sequences, build the library according to the following reaction procedures and systems:...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses an aptamer screening method and application thereof. The method can be used for screening aptamers combined with small molecules. The screening method disclosed by the invention can be used for solving the problems of difficulty in experimental design, complex screening flows and the like in the existing SELEX technology, and more importantly, a RNA aptamer can be obtained by screening by using the method, is an aptamer enzyme on one hand, is an artificial riboswitch on the other hand, and can be applied to the 5'or 3 'end of a gene to directly regulate and control the expression of the gene. In a word, the method disclosed by the invention can be used for generating the aptamers combined with the small molecules, so that the aptamers can be applied to various types of detection, diagnosis assistance and the like, and can also be used for regulating and controlling gene expression as the artificial riboswitch.

Description

technical field [0001] The invention belongs to the technical field of analysis and detection, and specifically relates to an aptamer and a screening method. Background technique [0002] At present, aptamers are mainly obtained by an in vitro screening technique called "SELEX". Traditional SELEX technology starts with a synthetic random DNA library, and its screening process is tedious and time-consuming. Subsequently, various new SELEX technologies were developed, for example: SELEX for nitrocellulose membrane filtration, genomic SELEX (Genomic SELEX), small RNA transcriptomic SELEX (smaRt-SELEX), Capture-SELEX etc. These improved technologies make SELEX more widely used. Unfortunately, the existing SELEX technology still has problems such as difficult experimental design and complicated screening process. Contents of the invention [0003] The purpose of the present invention is to overcome the shortcomings of the prior art and provide an aptamer screening method and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/10C12N15/115
CPCC12N15/1048C12N15/115C12N2310/16C12N2320/13C12Q2521/337C12Q2531/113C12Q2525/173C12Q2563/131C12Q2563/143C12Q2563/149
Inventor 李三暑段安琪
Owner HUAQIAO UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap