Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Polypeptide for increasing amylose content of plants, and nucleic acid and application thereof

A polynucleotide and plant technology, applied in the fields of crop genetics and biotechnology, can solve problems such as increasing amylose content, and achieve the effect of increasing amylose content

Active Publication Date: 2021-07-27
SHANDONG SHUNFENG BIOTECH CO LTD
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] At present, there is no report on increasing amylose content by mutating the waxy gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Polypeptide for increasing amylose content of plants, and nucleic acid and application thereof
  • Polypeptide for increasing amylose content of plants, and nucleic acid and application thereof
  • Polypeptide for increasing amylose content of plants, and nucleic acid and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0123] Example 1. Construction of gene editing vectors and screening of mutation sites

[0124] 1. Construct the ABE-nCas9 base editor targeting rice endogenous GBSS1 gene (such as figure 1 shown)

[0125] The ABE base editor can realize the base conversion of A / T->G / C within a certain sequence window range. The present invention uses the ABE-nCas9 base editor as a carrier to design sgRNA in the rice endogenous GBSS1 gene ( The sgRNA shown in Table 1) were respectively cloned into the ABE-nCas9 vector to form a base editor targeting the rice endogenous GBSS1 gene, and the amino acid encoded by the rice endogenous GBSS1 gene is shown in SEQ ID No.1.

[0126] Table 1 The sgRNA sequence targeting the rice GBSS1 gene

[0127] sgRNA ID guide-PAM sequence (5'-3') A-GBSS10 ATGCAGGAGGACGTCCAGAT (SEQ ID NO. 8)

[0128] 2. Genetic transformation of rice and identification of transgenic plants

[0129] The rice variety Xiushui 134 was used as the experimental m...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides polypeptide for increasing the amylose content of plants, and nucleic acid and an application thereof, relates to mutant GBSS1 polypeptide, nucleic acid and an application thereof, in particular to the mutant GBSS1 polypeptide, the nucleic acid and the application of the mutant GBSS1 polypeptide in plant breeding, and particularly provides the mutant GBSS1 polypeptide, compared with parent GBSS1 polypeptide, the mutant GBSS1 polypeptide generates mutation at 427th amino acid and / or the 428th amino acid corresponding to the SEQ ID NO.: 1. The plant subjected to GBSS1 mutation has very high amylose content, and has a very wide application prospect in cultivation of plants with high amylose content.

Description

technical field [0001] The invention belongs to the fields of biotechnology and crop genetic breeding, and relates to a polypeptide, nucleic acid and application thereof for increasing the amylose content of plants, in particular to a GBSS1 mutant protein and its method and application for increasing the amylose content of plants . Background technique [0002] Rice (Oryza sativa) is eaten by two-thirds of the world's population and is the main source of energy in the diet of at least half of them. Rice is a low-cost food that is easy and quick to prepare and is eaten with a variety of dishes. [0003] Rice is mainly composed of carbohydrates, mainly in the form of starch (90%) in the endosperm. Starch is widely used in food, paper and chemical industries. Starch can be divided into amylose and amylopectin according to the structure. Amylose is an essentially linear molecule in which the D-glucose units are linked by α-1.4 glycosidic linkages, while amylopectin contains ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/10C12N15/54C12N15/82A01H5/00A01H6/46
CPCC12N9/1051C12N15/8245C12Y204/01242
Inventor 张金山牛小牧
Owner SHANDONG SHUNFENG BIOTECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com