Specific primer pair for identifying lissorhoptrus oryzophilus and application of specific primer pair
A rice water weevil and primer pair technology, applied in the biological field, can solve the problems of unstable results, poor repeatability, non-specific PCR products and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Example 1 Sample DNA extraction
[0022] The genomic DNA extraction of rice water weevil and rice weevil adopts the kit method, and the kit used is Ezup column animal genomic DNA extraction kit; purchased from Sangon Bioengineering Co., Ltd. The specific operation steps are as follows:
[0023] (1) Insect samples preserved by immersion in absolute ethanol, the single-headed worms were separated, washed twice with sterile water, and placed in sterile water for 24 hours to completely remove ethanol residues. Then the worms were placed on sterilized filter paper to dry;
[0024] (2) Put the dried sample into a new 1.5mL sterilized centrifuge tube, add the digestive solution and fully grind the sample with an electric grinder, and perform DNA extraction according to the DNAEzup Columnar Animal Genome Extraction Kit Operation Manual;
[0025] (3) When the sample DNA is on the adsorption column in the last step, add 50 μL of sterilized deionized water and let it stand for 3...
Embodiment 2
[0027] Example 2: RAPD amplification of sample DNA
[0028] According to the principle of RAPD, 20 primers of RAPD 10-mer Set F of BGI random primer set were selected for PCR screening of rice water weevil and rice weevil DNA samples.
[0029] Tiangen 2×Taq PCR MasterMix II reagent was used for PCR amplification reaction, and the total reaction system was 25 μL, including: 1 μL of DNA to be tested; 1 μL of random primers; 12.5 μL of 2×Taq PCR MasterMix II; 10.5 μL of sterile water. The concentration of the DNA of the sample to be tested is not less than 400pg / μL; the molar concentration of the random primer is 10μM. The PCR program was: 95°C for 3 min; 95°C for 30s, 40°C for 45s; 72°C for 1 min, a total of 35 cycles; 72°C for 2 min, and the PCR product was stored at 4°C. 3 μL of PCR products were used for agarose gel electrophoresis to detect amplification results. The agarose gel was 1.0%, the voltage used was 180V, and the gel imaging system was used to take pictures. The...
Embodiment 3
[0030] Example 3: Design and identification of rice water weevil-specific primers
[0031] The obtained base sequences were analyzed, and specific primers were designed using Primer Premier 5 software. Upstream primer sequence: SEQ ID NO: 1: ATGTGCCCACCTCTGTTCTT, downstream primer sequence: SEQ ID NO: 2: ACTGCATCGTCAGTAACTAT. The primers were sent to Sangon Bioengineering Co., Ltd. for synthesis.
[0032] The DNA of existing samples of rice water weevil at different developmental stages (egg, early larvae, mature larva, pupa, female adult and male adult) and rice weevil DNA were amplified and identified. Tiangen 2×Taq PCR MasterMixⅡ reagent was used for PCR amplification reaction, and the total reaction system was 25 μL, including: 1 μL of DNA to be tested; 0.5 μL of upstream primers; 0.5 μL of downstream primers; 12.5 μL of 2×Taq PCR MasterMixⅡ; 10.5 μL of sterile water μL. The concentration of the DNA of the sample to be tested is not less than 400pg / μL; the molar concent...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap