Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A drug for treating acute myocardial infarction

A technology for acute myocardial infarction and drugs, applied in the field of cardiovascular disease drugs, can solve problems such as unclear related mechanisms

Active Publication Date: 2021-09-07
QINGDAO CENT HOSPITAL
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the relevant mechanism of ncRNAs in the treatment of acute myocardial infarction is not yet clear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A drug for treating acute myocardial infarction
  • A drug for treating acute myocardial infarction
  • A drug for treating acute myocardial infarction

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Design and validation of LOC101928034 overexpression plasmid

[0024] (1) According to the RNA nucleic acid sequence NR_125947.1 of LOC101928034, SEQ ID NO.1 and the EcoR I and Xho I restriction sites of pcDNA3.1, primers were designed to construct the pcDNA3.1-LOC101928034 overexpression plasmid. The primer sequences are as follows;

[0025] Upstream primer: GAATTCACACAACTCACCAAACCA, SEQ ID NO.2

[0026] Downstream primer: CTCGAGCCGCACAAACCTATGAGG, SEQ ID NO.3

[0027] (2) Human cardiomyocytes AC16 were inoculated in 6-well plates. When the cell density reached 80%, the cells were transfected with lip2000 liposomes. The control group was transfected with pcDNA3.1, and the experimental group was transfected with pcDNA3.1- LOC101928034, set 3 repetitions for each group;

[0028] (3) After 48 hours of transfection, the medium was discarded, and each well was washed twice with 2ml PBS. After discarding the PBS, 1ml Trizol was added for 10 minutes;

[0029] (4) After pip...

Embodiment 2

[0068] Overexpression of LOC101928034 promotes the proliferation of cardiomyocytes

[0069] (1) Prepare human cardiomyocytes AC16 transfected with pcDNA3.1 and pcDNA3.1-LOC101928034 into a cell suspension, and adjust the cell density to 50,000 / ml;

[0070] (2) Inoculate 100ul of cell suspension in a 96-well plate, set 5 duplicate wells for each group, place in a cell culture incubator, and culture for 48 hours;

[0071] (3) After the incubation, use MTT to detect the absorbance at 570nm.

[0072] Experimental results such as figure 2 As shown, the absorbance value of the pcDNA3.1 group is 0.409±0.036, and the absorbance value of the pcDNA3.1-LOC101928034 group is 0.590±0.033. From the above results, it can be seen that the overexpression of LOC101928034 can effectively promote the proliferation of cardiomyocytes.

Embodiment 3

[0074] Overexpression of LOC101928034 promotes angiogenesis of vascular endothelial cells

[0075] (1) Take Matrigel out of the -20°C refrigerator and put it in a 4°C refrigerator to melt overnight. On the next day, add 40ul of Matrigel into the pre-cooled 96-well plate, and gently shake and tile;

[0076] (2) Prepare the vascular endothelial cells HUVEC transfected with pcDNA3.1 and pcDNA3.1-LOC101928034 into a cell suspension, and add 2×10 4 cells;

[0077] (3) Place the 96-well plate in a cell culture incubator at 37°C, take pictures after culturing for 4 hours, and calculate the total branch length.

[0078] Experimental results such as image 3 As shown, it can be seen from the figure that the overexpression of LOC101928034 can effectively promote the angiogenesis of vascular endothelial cells (the relative fold is 1.399±0.144).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
absorbanceaaaaaaaaaa
absorbanceaaaaaaaaaa
Login to View More

Abstract

The invention provides a drug for treating acute myocardial infarction, which belongs to the technical field of cardiovascular disease drugs. The present invention proves for the first time that the overexpression of non-coding RNA LOC101928034 can effectively promote the proliferation of cardiomyocytes and the angiogenesis of vascular endothelial cells. Therefore, the overexpression reagent of LOC101928034 can be used to prepare cardiomyocyte proliferation promoters and vascular endothelial cell angiogenesis agent, and then it can be used to prepare the medicine for treating acute myocardial infarction, and provide a new medicine for the treatment of acute myocardial infarction.

Description

technical field [0001] The invention belongs to the technical field of cardiovascular disease drugs, in particular to a drug for treating acute myocardial infarction. Background technique [0002] Acute myocardial infarction is a cardiovascular disease with the highest morbidity and mortality in the world. It is caused by myocardial necrosis caused by acute continuous coronary ischemia and hypoxia, which eventually leads to myocardial remodeling and irreversible decline in new functions. At present, the main clinical treatment methods for patients with myocardial infarction are drug therapy, interventional therapy, thrombolytic therapy and surgical treatment. Although these methods have effectively improved the survival rate of patients with myocardial infarction, these treatment methods cannot effectively solve the problem of myocardial repair. [0003] Non-coding RNA is a class of RNA that does not code for protein in the whole genome, and these RNA molecules lack open re...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K48/00A61K31/7088A61K45/00A61P9/04A61P9/10
CPCA61K31/7088A61K45/00A61P9/04A61P9/10
Inventor 于婧赵魏芳张璐刘广焕
Owner QINGDAO CENT HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com