Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Phospholipase D gene for promoting plant root development and application thereof

A plant root system and phospholipase technology, applied in the biological field, to achieve the effects of promoting plant breeding, improving utilization efficiency, and enhancing growth

Active Publication Date: 2021-04-13
LANZHOU UNIVERSITY
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This patented technology allows scientists to study how certain genes can be used to improve crops' ability to resist damage from environmental factors like dryness or excessive rainwater during periods of abnormal weather conditions called salinity (salt). These genes are found naturally occurring within cells but they cannot normally function properly when exposed outside their natural environment due to lack of necessary elements needed inside them. By modifying these genes with specific chemical compounds, researchers may create better crop varieties through developing more effective methods for growing durable greenery materials.

Problems solved by technology

This patented describes how certain specific proteases called lysozyme act upon living things like trees or grasses during their life cycle. These enzymes help breakdown cell walls and absorb moisture around themselves while they work together to create more stable structures over longer periods. They play key roles in improving crop health and reducing environmental damage caused through extreme weather conditions. However, there may be some cases where these enzymatic activities could harm crops due to excessive salinity levels at high altitudes.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Phospholipase D gene for promoting plant root development and application thereof
  • Phospholipase D gene for promoting plant root development and application thereof
  • Phospholipase D gene for promoting plant root development and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Embodiment 1 promotes the cloning of the phospholipase D gene PeuPLDζ4 sequence of root system development and homologous gene PeuPLDζ3

[0044] Utilize 2% CTAB (W / V), 2% PVP (W / V), 25mmol / L EDTA, 100mmol / L Tris-HCl pH 8.0, 2.0mol / L NaCl, 0.5g / L spermidine. After sterilization, add 2% (V / V) β-mercaptoethanol) method to extract total RNA of Populus euphratica leaf tissue, and its specific method is:

[0045] Collect 1 g of fresh Populus euphratica leaf tissue material, immediately place it in liquid nitrogen and grind it into powder, add it to a 1.5ml centrifuge tube, then add 800 μl CTAB preheated at 65°C, mix well, and put it in a water bath at 65°C for 8 minutes; add 1ml CI ( Chloroform: isoamyl alcohol = 24:1) solution, mix well, 4°C, centrifuge at 12000g for 10min; transfer the supernatant aqueous phase to a new 1.5ml centrifuge tube, add 1ml CI solution, mix well, 4°C, 12000g Centrifuge for 10 min; transfer the 2 tubes of the supernatant aqueous phase to a new 1.5...

Embodiment 2

[0057] Example 2 Subcellular localization of PeuPLDζ3 / 4 gene

[0058] Construction of Populus euphratica PeuPLDζ3 and PeuPLDζ4 genes respectively fused with yellow fluorescent protein YFP expression vectors: the sequence-verified fragments obtained in Example 1 were recombined into pDONR / Zeocin vectors by BP reaction, transformed into E. The entry clone was obtained by Zeocin screening, and then the plasmid was extracted, and the PeuPLDζ3 and PeuPLDζ4 genes were recombined into the pEarleyGate 101 vector by LR reaction, transformed into Escherichia coli DB3. Expression vectors pEarleyGate 101-PeuPLDζ3 and pEarleyGate 101-PeuPLDζ4.

[0059] Preparation of Arabidopsis protoplasts: Arabidopsis protoplasts were prepared strictly according to the method reported by Yoo et al. in Nature Protocol in 2007. Briefly, 10-15 pieces of Arabidopsis leaves that were 4 weeks old after germination were cut, Cut into strips with a width of about 0.5-1mm, put in 10ml enzyme solution [20mM MES (...

Embodiment 3

[0062] Example 3 Identification of the expression pattern of Populus euphratica PeuPLDζ4

[0063] Sequence analysis was carried out by bioinformatics method, and the primer sequences of PeuPLDζ3 and PeuPLDζ4 promoters were designed.

[0064] PeuPLDζ3 promoter region primers:

[0065] 5' end primer: ATCAGTGATCTTCGCAGGTCG

[0066] 3' end primer: GAATGGTTGGTTTGGGGTTT

[0067] PeuPLDζ4 promoter region primers:

[0068] 5' end primer: AGCCACGCTCTGTTGATCTTCC

[0069] 3' end primer: CGAATGGTTGGTTTGGGGTTT

[0070] Utilize CTAB (2% CTAB (W / V), 20mmol / L EDTA, 100mmol / L Tris-HCl pH 8.0, 1.4mol / L NaCl, 1% (V / V) β-mercaptoethanol) method to extract total tissue of Populus euphratica leaf tissue DNA, the specific method is:

[0071] Collect 1g of fresh Populus euphratica leaf tissue material, immediately place it in liquid nitrogen and grind it into powder, add it to a 2.0ml centrifuge tube, then add 800μl CTAB preheated at 65°C, mix well, put it in a water bath at 65°C for 60min, and...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology, particularly relates to a phospholipase D gene PeuPLD zeta 4 for promoting plant root development and an expression vector, cell line and host bacteria thereof, and particularly discloses application of the gene PeuPLD zeta 4 to breeding of transgenic plants, and the plants include dicotyledonous plants and monocotyledonous plants. The populus euphratica PeuPLD zeta 4 gene separated by the invention is phospholipase D capable of acting on cell membranes and cell nucleuses. The populus euphratica PeuPLD zeta 4 gene is over-expressed in the monocotyledonous plants and the dicotyledonous plants, and thus, the development of plant roots of the monocotyledonous plants and the development of plant roots of the dicotyledonous plants are both remarkably enhanced, and the utilization efficiency of the dicotyledonous plants and monocotyledonous plants to low-water-level underground water is also further improved, thereby enhancing the tolerance of the dicotyledonous plants and monocotyledonous plants to abiotic stress such as high salt and drought. The discovery of the gene has important theoretical and practical significance for culturing excellent crop varieties, especially drought-resistant and salt-resistant crop varieties, and promoting breeding of plants in deserts and arid regions.

Description

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Owner LANZHOU UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products