Cabbage type rape male sterility gene, protein, vector, engineering bacterium and application of cabbage type rape male sterility gene
A technology for male sterility gene and Brassica napus, which can be used in genetic engineering, application, plant genetic improvement and other directions, and can solve problems such as pollen production
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Analysis on Genetic Rule of Nuclear Dominant Sterile Material of Brassica napus
[0031] 1. Experimental materials
[0032] The sterile line is called E2A and the fertile line is called E2B. EMS mutagenesis was carried out on Brassica napus inbred line TE5 to obtain a sterile single plant E2A (the sterile plant is called E2A, and the fertile plant is called E2B), and the sterile single plant was crossed with Zhongshuang 11, And use Zhongshuang 11 as the recurrent parent to backcross to obtain near isogenic lines. with BnMS5 b and BnMS5 d Rapeseed male sterility caused by the gene is affected differently by temperature. After different temperature treatments in the flowering stage of rapeseed, the fertility of the single sterile E2A plant is not affected by temperature. The sterile plant E2A had poor fruiting under the condition of artificial assisted pollination or natural pollination, basically no fruiting ( figure 1 , the seed setting of Brassica napus E2B and E2...
Embodiment 2
[0038] Brassica napus Dominant Nuclear Sterility Gene BnMS5 f with BnMS5 d Allelic analysis of
[0039] Zeng et al. (Xinhua Zeng, Wenpin Li, Yuhua Wu, Fang Liu, Junling Luo, Yinglong Cao, Li Zhu, Yunjing Li, Jun Li, Qingbo You, Gang Wu. Fine mapping of a dominantthermo-sensitive genic male sterility gene (BntsMs) in rapeseed (Brassicanapus) with AFLP-and Brassica rapa-derived PCR markers.Theor Appl Genet.2014,127:1733–1740) found a thermosensitive nuclear male sterile line TE5A in Brassica napus, and cloned it using map-based cloning sterile gene BnMS5 d . To verify whether the E2A sterility gene is related to BnMS5 d Gene allele, the present invention utilizes homozygous E2A sterile line and fertile homozygous TE5A under low temperature conditions (genotype is BnMS5 d BnMS5 d ) to get F 1 . Will F 1 Planted in the greenhouse, keep a stable temperature of 25°C during the flowering period, and observe the F 1 Plant fertility, F 1 All showed complete infertility. Use...
Embodiment 3
[0043] Brassica napus Dominant Nuclear Sterile Gene BnMS5 f functional verification of
[0044] 1. BnMS5 f Rapeseed Transgenic Experiment
[0045] In this example, the plant expression vector pCAMBIA2300 was used as the transgenic vector of Brassica napus. The vector encodes a bacterial origin of replication (ori), a kanamycin resistance gene (Kan'), a CaMV35S promoter, a terminator for the NOS gene, and a restriction enzyme multiple cloning site. By analyzing the relationship between the restriction site of the BAC clone sequence carrying the candidate gene and the candidate gene, it was amplified using primers ZT-1L, ZT-1R and high-fidelity PCR technology (PhusionTM High-Fidelity DNAPolymerse, from New England Biolads Company) A 3.951kb fragment,
[0046] ZT-1L (forward primer): CCGGAATTCCTATTAATAAATTAATGACTCAGCT (SEQ ID NO.5);
[0047] ZT-1R (reverse primer): CAACTGCAGCCAAGAAGAGAATTGATTCCACA (SEQ ID NO. 6).
[0048] This fragment contains Ecol I and Pst I restriction ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com