Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Specific PCR identification primer for identifying bulbus fritillariae ussuriensis and application of specific PCR identification primer

A kind of fritillary, specific technology, applied in the field of medicine, can solve the problem of identifying no public reports and the like

Pending Publication Date: 2020-10-27
HENAN UNIV OF CHINESE MEDICINE
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there has been no public report on the identification of Fritillaria fritillaria with specific primers

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific PCR identification primer for identifying bulbus fritillariae ussuriensis and application of specific PCR identification primer

Examples

Experimental program
Comparison scheme
Effect test

experiment example 1

[0028] Experimental example 1 Sequence download and comparison analysis

[0029] Download the ITS sequences of Fritillaria and other varieties of Fritillaria from the NCBI database, and use MAGA-X for multiple sequence alignment analysis of all sequences to find the difference between the sequence of Fritillaria and other sequences. Based on these SNP positions Dian used the primer design software Oligo7 to design the specific primers of Fritillaria, which were named PB-Y1F and PB-Y1R respectively.

experiment example 2

[0030] Experimental example 2 utilizes the method for specific primer identification flat Fritillaria

[0031] 1. DNA extraction

[0032]The random sampling method was used to take samples. The surface of the sample was wiped with 75% ethanol, and after drying, it was pulverized with a tissue grinder. The total DNA was extracted according to the instructions of the Tiangen Express Plant Genomic DNA Extraction Kit, and the concentration and absorbance (A260 / A280) of the extracted DNA were detected using an ultra-micro-volume ultraviolet spectrophotometer, and the obtained DNA samples were stored at -20 °C spare. Use universal primers ITS2F: 5' ATGCGATACTTGGTGTGAAT 3'; ITS2R: 5'GACGCTTCTCCAGACTACAAT 3' for PCR reaction to detect the quality of template DNA. The total volume of the PCR reaction system was 25 μL, including 12.5 μL of 2×Taq Plus Master Mix, 1 μL (10 μmol) of upstream and downstream primers, 1 μL of DNA template, and 9.5 μL of ddH2O. PCR reaction conditions: 94°C...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a specific PCR identification primer for identifying bulbus fritillariae ussuriensis and an application of the specific PCR identification primer, which can effectively solvethe problem in accurate identification of the bulbus fritillariae ussuriensis by the specific primer for identifying the bulbus fritillariae ussuriensis. The PCR identification primer is a primer paircomposed of two single-stranded DNA molecules, namely an upstream primer PB-Y1F:5'CGGGCGGACAATTTACTT 3' and a downstream primer PB-Y1R:5'AGATAGAGAGCGGGCGTC 3'; a base at the tail end of the 3' end ofa forward primer is located on a 122nd deletion site; and the size of a PCR amplification product is 186 bp. The primer pair provided by the invention can be effectively used for identifying the bulbus fritillariae ussuriensis, the detection method is easy to operate, simple, rapid and high in accuracy, the primer pair can be effectively applied to identification work of a large batch of the bulbus fritillariae ussuriensis, the quality and the medicinal value of the bulbus fritillariae ussuriensis are ensured, and remarkable economic and social benefits are achieved.

Description

technical field [0001] The invention relates to medicine, in particular to a specific PCR identification primer for identifying Fritillaria fritillaria and its application. Background technique [0002] Flat Fritillaria is a perennial plant of the genus Fritillaria in the family Liliaceae. Fritillaria ussuriensis Maxim. of dried bulbs. Bitter in the mouth, cold in nature. Return lung, heart channel. Efficacy is clearing heat and resolving phlegm, moistening lung and relieving cough, dispelling stagnation and stagnation. For the treatment of cough due to lung heat, hematemesis due to restlessness and heat, bronchitis and other diseases. Many articles have reported in modern Pingbei research that Pingbei has good biological activity and clinical efficacy similar to Chuanbei, and it is a suitable substitute for Chuanbei, and its growth environment requirements are low. Compared with artificial planting techniques Mature, short growth cycle (2 to 3 years), high yield and lo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6895C12Q1/6858C12N15/11
CPCC12Q1/6895C12Q1/6858C12Q2600/156C12Q2565/125C12Q2531/113C12Q2563/185
Inventor 陈随清杨灏练从龙张雪雨
Owner HENAN UNIV OF CHINESE MEDICINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com