KASP Molecular Marker and Its Application of the Main Qtl for Spikelet Fruity at the Top of Wheat Spike
A molecular marker and wheat technology, applied in the field of molecular genetic breeding, can solve problems such as the slow progress in genetic research of ear top fruitiness and the difficulty of complex research on the mechanism of ear top fruitiness, so as to improve breeding efficiency, reduce time and labor costs, and improve The effect of detection efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] [Mining significant association loci controlling panicle top spikelet fruiting by genome-wide association analysis]:
[0032] Test materials: The natural population used for association analysis consists of 220 wheat varieties, of which 213 are from China and 7 are from abroad. Among the 7 materials from abroad, 3 were from Italy, 1 from the United States, 1 from Mexico, 1 from Chile, and 1 from Japan; among the 213 materials from China, 65 were from Jiangsu, 25 from Henan, 19 from Shandong, and 18 from Shaanxi 16 in Sichuan, 13 in Anhui, 10 in Hunan, 6 in Hubei, 7 in Beijing, 7 in Hebei, 4 in Gansu, 3 in Zhejiang, 3 in Fujian, 3 in Shanxi, 2 in Heilongjiang, 1 in Jiangxi, 1 in Guizhou and 1 in Yunnan, and 9 materials of unknown origin.
[0033] Field test: The tested natural populations were planted in Jingzhou, Hubei and Yangzhou, Jiangsu in 2013-2014 and 2014-2015 respectively, and in Xinxiang, Henan in 2015-2016. The field experiment was designed according to rand...
Embodiment 2
[0038] 【Positioning the main QTL controlling the number of grains set in spikelets at the top of the panicle】:
[0039] Test materials: Yangmai 17 and Ningmai 9 are the main winter wheat varieties in the middle and lower reaches of the Yangtze River in my country. Yangmai 17 has excellent comprehensive agronomic properties, but poor ear firmness. One of the main characteristics of Ningmai 9 is ear firmness Good sex. The present invention uses Yangmai 17 as the female parent and Ningmai 9 as the male parent to construct F 2:7 Generation RIL population, including 190 families.
[0040] Field experiment: The tested genetic population and its parents including 190 families were identified in Yangzhou, Jiangsu, Nanjing, and Yizheng, Jiangsu, respectively, from 2017 to 2019. The field experiment was designed according to random blocks, and three repetitions were set up. In each repetition, each material was planted in 3 rows, 50 grains / row, the row length was 2 meters, and the row ...
Embodiment 3
[0046] [Development of KASP molecular markers for main QTL of spikelet fruiting at the top of wheat spikelets]:
[0047] According to the characteristics of SNP mutation information, a specific set of KASP primers is designed, which consists of the first upstream primer, the second upstream primer and the downstream primer. The 3' end of the upstream primer set is the allelic variant base A / G, and the sequence selection of the downstream primers should ensure that the length of the amplified product is 60-120bp. The sequence of the first upstream primer is 5'-GAAGGTGACCAAGTTCATGCTGGTTGATCAAACGCGCCATACTTCA-3', the sequence of the second upstream primer is 5'-GAAGGTCGGAGTCAACGGATTGGTTGATCAAACGCGCCATACTTCG-3'; the sequence of the downstream primer is 5'-ATGTTGGTTAATTTGTCATGTTGAC-3'. Wherein, the 5' end of the first upstream primer is connected to the FAM fluorescent tag sequence "GAAGGTGACCAAGTTCATGCT", and the 5' end of the second upstream primer is connected to the HEX fluoresc...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com