A kind of Brassica napus nac47 transcription factor and its preparation method and application
A technology of Brassica napus and transcription factors, applied in the field of biological genetic engineering, can solve the problem of less rape
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] 1. Cloning and sequence determination of the cDNA sequence of rapeseed NAC47 gene.
[0030] According to the sequence information of the sequenced genome of Brassica napus that has been published, two pairs of gene-specific primers are designed, and the coding region of the gene is amplified using Brassica napus as a template. The primer sequences are:
[0031]BnaNAC47-F:
[0032] 5'TTAGGTCATGATAAGCAAGGATCCAAGATCAAG3'; BnaNAC47-R:
[0033] 5'CGCGTCGACGCCTTGATACTTAAGGTGAG3'.
[0034] The total RNA of rapeseed seedlings was extracted with Plant RNAkit (Omega). After quantification by NanoDrop1000, 2.5 μg of total RNA was taken, and the reverse transcription reaction was carried out with RevertAid RNase H-First Strand cDNA Synthesis Kit (Fermentas) according to the instructions.
[0035] 2. PCR reaction system (50μL)
[0036] 5 PrimeStarbuffer 10μL;
[0037] cDNA template: 1 μL;
[0038] dNTPs (10mM each) 1 μL;
[0039] PrimerF (20 μ M) 1 μ L;
[0040] Primer R (20 ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com