Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of Brassica napus nac47 transcription factor and its preparation method and application

A technology of Brassica napus and transcription factors, applied in the field of biological genetic engineering, can solve the problem of less rape

Active Publication Date: 2022-04-26
NORTHWEST A & F UNIV
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the research on the function of NAC transcription factors is currently mainly focused on the model plants Arabidopsis and rice, and there are relatively few studies on rapeseed.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of Brassica napus nac47 transcription factor and its preparation method and application
  • A kind of Brassica napus nac47 transcription factor and its preparation method and application
  • A kind of Brassica napus nac47 transcription factor and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] 1. Cloning and sequence determination of the cDNA sequence of rapeseed NAC47 gene.

[0030] According to the sequence information of the sequenced genome of Brassica napus that has been published, two pairs of gene-specific primers are designed, and the coding region of the gene is amplified using Brassica napus as a template. The primer sequences are:

[0031]BnaNAC47-F:

[0032] 5'TTAGGTCATGATAAGCAAGGATCCAAGATCAAG3'; BnaNAC47-R:

[0033] 5'CGCGTCGACGCCTTGATACTTAAGGTGAG3'.

[0034] The total RNA of rapeseed seedlings was extracted with Plant RNAkit (Omega). After quantification by NanoDrop1000, 2.5 μg of total RNA was taken, and the reverse transcription reaction was carried out with RevertAid RNase H-First Strand cDNA Synthesis Kit (Fermentas) according to the instructions.

[0035] 2. PCR reaction system (50μL)

[0036] 5 PrimeStarbuffer 10μL;

[0037] cDNA template: 1 μL;

[0038] dNTPs (10mM each) 1 μL;

[0039] PrimerF (20 μ M) 1 μ L;

[0040] Primer R (20 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biogenetic engineering, and in particular relates to a NAC47 transcription factor of Brassica napus and its preparation method and application. Specifically disclosed the gene structure of NAC47 transcription factor of Brassica napus, its preparation method and its application in positively regulating the senescence of rapeseed leaves; and disclosed that the expression of Brassica napus NAC47 gene can cause the necrosis of cells to cause the increase of electrical conductivity, The increase of hydrogen peroxide content, the decrease of chlorophyll content, the increase of anthocyanin content and the increase of malondialdehyde content; make the expression of RbohD, RbohF, YLS9, BFN1, CEP1 and two VPE genes better in Brassica napus controlled activation and expression.

Description

technical field [0001] The invention belongs to the technical field of biogenetic engineering, in particular to a NAC47 transcription factor of Brassica napus and its preparation method and application. Background technique [0002] During the growth process, the yield and quality of crops are affected by a series of factors, including drought, salt damage, heat damage, and cold damage. It has been reported that more than 50% of the world's major crops are lost (Ahuja et al., 2010; Lobell et al., 2011; Shao et al., 2009). Rapeseed is an important oil crop, so it is of great significance to study its stress resistance mechanism, enhance its stress resistance ability, and increase its yield. [0003] Many reports at home and abroad have shown that reactive oxygen species (ROS) are important signaling molecules in plants that regulate the response and tolerance to various environmental stresses and pathogens. Maintaining a moderate level of ROS in plant cells is an important f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/10A01H5/00A01H6/20
CPCC07K14/415C12N15/8266C12N15/825C12N15/8243
Inventor 江元清杨博陈芹芹牛芳芳燕敬利
Owner NORTHWEST A & F UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com