Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Fusion protein TNB with effects of thrombolysis and cerebral protection and coding genes and application of fusion protein

A fusion protein and thrombolysis technology, applied in the biological field, can solve the problem that only thrombolysis can not achieve the therapeutic effect, and achieve the effect of broad application prospects.

Inactive Publication Date: 2020-01-31
PEKING UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the existence of these mechanisms of ischemia-reperfusion injury, thrombolytic therapy alone cannot achieve the desired therapeutic effect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein TNB with effects of thrombolysis and cerebral protection and coding genes and application of fusion protein
  • Fusion protein TNB with effects of thrombolysis and cerebral protection and coding genes and application of fusion protein
  • Fusion protein TNB with effects of thrombolysis and cerebral protection and coding genes and application of fusion protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] The design of embodiment 1 target gene

[0039] The purpose of the design of the present invention is to obtain the fusion protein with dual functions of thrombolysis and brain protection. First, the thrombolytic protein NR6 with thrombus targeting was obtained by introducing two RGD sequences from AcAP5; then the fusion protein TBN was obtained by fusing the anti-apoptotic unit BH4 and NR6, and a coagulation protein was introduced between the BH4 fragment and NR6 fragment of TBN Enzyme and MMP9 enzyme cutting site, when TBN enters the body, it can be cut by thrombin and / or MMP9 to produce BH4 fragments and NR6 fragments, NR6 plays a role in thrombolysis in blood vessels, and BH4 enters brain tissue to play a role in neuroprotection; And in order to improve the efficiency of BH4 crossing the blood-brain barrier and entering the brain, TAT penetrating peptide was fused at the N-terminal of TBN.

[0040] 1. Introduce two RGD sequences into AcAP5 to obtain thrombolytic pr...

Embodiment 2

[0042] Example 2 Synthesis of cDNA molecules encoding NR6 and TBN proteins

[0043] 1. Encoding the target gene sequence according to the preferred codons of E. coli

[0044] NR6

[0045] catatgccgcgcggcgatatgccgggctctaaagcgtatccggaatgcggtgaaaatgaatggctggatgattgtggcacccagaaaccgtgcgaagcgaaatgcaatgaagaaccgccggaagaagaagatccgatttgccgctctcgtggctgtctgctgccgccggcgtgcgtttgcaaagatggcttttatcgtgataccgtgattggcgattgtgttcgtggcgatgaatgcgatcagcatgaaattattcatgtgtaatgaggatcc

[0046] TBN

[0047]catatgtacggtcgtaaaaaacgtcgtcagcgtcgtcgtatgtctcagtctaaccgtgaactggttgttgacttcctgtcttacaaactgtctcagaaaggttactcttggtctcagttcggtggtggttctccgctgggtctgtgggctggtggttctctggttccgcgtggttcttctccgcgcggcgatatgccgggctctaaagcgtatccggaatgcggtgaaaatgaatggctggatgattgtggcacccagaaaccgtgcgaagcgaaatgcaatgaagaaccgccggaagaagaagatccgatttgccgctctcgtggctgtctgctgccgccggcgtgcgtttgcaaagatggcttttatcgtgataccgtgattggcgattgtgttcgtggcgatgaatgcgatcagcatgaaattattcatgtgtaatgaggatcc

[0048] 2. Primer Design

[0049]

[0050] 3. Amplifi...

Embodiment 3

[0075] The construction of embodiment 3 expression vector

[0076] 1. The experimental method in this experiment is mainly operated according to the "Molecular Cloning Experiment Guide" (third edition) J. Sambrook (Sambrook and Russell et al., 2002) and the product manual provided by the company;

[0077] 2. The pET-30a and pET-16b vectors (purchased from Invitrogen) and the target fragment (cDNA synthesized in Example 2) were double digested with Nde I and BamH I;

[0078] 3. T4 ligase connection;

[0079] 4. Transform competent Escherichia coli E.coli DH5α, screen NR6 positive clones with ampicillin medium, and screen TBN positive clones with kanamycin medium;

[0080] 5. Cultivate positive bacteria;

[0081] 6. Extract and purify the plasmid, and the electrophoresis results of the recombinant plasmid after double enzyme digestion are as follows: Figure 4 As shown in , the shorter fragment on the way is the target fragment, and the longer one is the plasmid fragment, ind...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
The inside diameter ofaaaaaaaaaa
Tube chiefaaaaaaaaaa
The inside diameter ofaaaaaaaaaa
Login to View More

Abstract

The invention provides a fusion protein TNB with effects of thrombolysis and cerebral protection and coding genes and application of the fusion protein, and discloses a fusion protein with dual effects of thrombolysis and neuroprotection and coding genes and application of the fusion protein. The amino acid sequence of the fusion protein is shown in SEQ ID No. 2. In addition, the invention also discloses nucleotide sequences which are used for encoding the fusion protein, and a preferable nucleotide sequence is shown in SEQ ID No. 4. The pharmacological activity of the fusion protein is evaluated by using a rat arteriovenous bypass thrombolysis model and an embolization model of an artery in a mouse thromboembolic brain, and it is shown that the fusion protein has a good thrombolytic effect and a function of reduction of ischemic brain injuries. A new technology is provided for treatment of acute ischemic stroke and other thrombotic diseases, and the fusion protein has broad application prospects.

Description

technical field [0001] The present invention relates to a fusion protein and its encoding gene and application, in particular to a fusion protein with dual functions of thrombolysis and neuroprotection and its encoding gene, and its application in the treatment of acute ischemic stroke. The present invention belongs to field of biotechnology. Background technique [0002] Stroke is one of the diseases with high morbidity and mortality in the world, and ischemic stroke accounts for about 80% of the total number of strokes (Moretti A., Ferrari F., Villa R.F., Neuroprotection for ischaemic stroke: Current status and challenges . Pharmacol Ther, 2015, 146:23-34.). At present, the early clinical treatment of ischemic stroke is mainly based on intravenous thrombolysis. After thrombolysis, the blood supply in the ischemic area is restored and the further expansion of the cerebral infarction area is prevented, but at the same time it will also cause reperfusion injury (Eltzschig H....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/62A61K38/17A61P7/02A61P9/10
CPCA61K38/00A61P7/02A61P9/10C07K14/4354C07K14/47C07K2319/00
Inventor 王银叶陈欢朱元军刘晓岩郑丹萍
Owner PEKING UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com