Fusion protein TNB with effects of thrombolysis and cerebral protection and coding genes and application of fusion protein
A fusion protein and thrombolysis technology, applied in the biological field, can solve the problem that only thrombolysis can not achieve the therapeutic effect, and achieve the effect of broad application prospects.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] The design of embodiment 1 target gene
[0039] The purpose of the design of the present invention is to obtain the fusion protein with dual functions of thrombolysis and brain protection. First, the thrombolytic protein NR6 with thrombus targeting was obtained by introducing two RGD sequences from AcAP5; then the fusion protein TBN was obtained by fusing the anti-apoptotic unit BH4 and NR6, and a coagulation protein was introduced between the BH4 fragment and NR6 fragment of TBN Enzyme and MMP9 enzyme cutting site, when TBN enters the body, it can be cut by thrombin and / or MMP9 to produce BH4 fragments and NR6 fragments, NR6 plays a role in thrombolysis in blood vessels, and BH4 enters brain tissue to play a role in neuroprotection; And in order to improve the efficiency of BH4 crossing the blood-brain barrier and entering the brain, TAT penetrating peptide was fused at the N-terminal of TBN.
[0040] 1. Introduce two RGD sequences into AcAP5 to obtain thrombolytic pr...
Embodiment 2
[0042] Example 2 Synthesis of cDNA molecules encoding NR6 and TBN proteins
[0043] 1. Encoding the target gene sequence according to the preferred codons of E. coli
[0044] NR6
[0045] catatgccgcgcggcgatatgccgggctctaaagcgtatccggaatgcggtgaaaatgaatggctggatgattgtggcacccagaaaccgtgcgaagcgaaatgcaatgaagaaccgccggaagaagaagatccgatttgccgctctcgtggctgtctgctgccgccggcgtgcgtttgcaaagatggcttttatcgtgataccgtgattggcgattgtgttcgtggcgatgaatgcgatcagcatgaaattattcatgtgtaatgaggatcc
[0046] TBN
[0047]catatgtacggtcgtaaaaaacgtcgtcagcgtcgtcgtatgtctcagtctaaccgtgaactggttgttgacttcctgtcttacaaactgtctcagaaaggttactcttggtctcagttcggtggtggttctccgctgggtctgtgggctggtggttctctggttccgcgtggttcttctccgcgcggcgatatgccgggctctaaagcgtatccggaatgcggtgaaaatgaatggctggatgattgtggcacccagaaaccgtgcgaagcgaaatgcaatgaagaaccgccggaagaagaagatccgatttgccgctctcgtggctgtctgctgccgccggcgtgcgtttgcaaagatggcttttatcgtgataccgtgattggcgattgtgttcgtggcgatgaatgcgatcagcatgaaattattcatgtgtaatgaggatcc
[0048] 2. Primer Design
[0049]
[0050] 3. Amplifi...
Embodiment 3
[0075] The construction of embodiment 3 expression vector
[0076] 1. The experimental method in this experiment is mainly operated according to the "Molecular Cloning Experiment Guide" (third edition) J. Sambrook (Sambrook and Russell et al., 2002) and the product manual provided by the company;
[0077] 2. The pET-30a and pET-16b vectors (purchased from Invitrogen) and the target fragment (cDNA synthesized in Example 2) were double digested with Nde I and BamH I;
[0078] 3. T4 ligase connection;
[0079] 4. Transform competent Escherichia coli E.coli DH5α, screen NR6 positive clones with ampicillin medium, and screen TBN positive clones with kanamycin medium;
[0080] 5. Cultivate positive bacteria;
[0081] 6. Extract and purify the plasmid, and the electrophoresis results of the recombinant plasmid after double enzyme digestion are as follows: Figure 4 As shown in , the shorter fragment on the way is the target fragment, and the longer one is the plasmid fragment, ind...
PUM
Property | Measurement | Unit |
---|---|---|
The inside diameter of | aaaaa | aaaaa |
Tube chief | aaaaa | aaaaa |
The inside diameter of | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com