Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

A kind of polypeptide with anticancer effect and its application

A technique of action, colon cancer, applied in the field of medicine

Active Publication Date: 2020-12-08
伽柏康(海南)控股有限公司
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] while selectively interfering with β-arrestin1 and ET A Interaction of R, able to block β-arrestin1 to ET A Aggregation of R, which may prevent β-arrestin1-mediated signaling pathway

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of polypeptide with anticancer effect and its application
  • A kind of polypeptide with anticancer effect and its application
  • A kind of polypeptide with anticancer effect and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1 Polypeptide TAT-ET A 1's get

[0037] (1) TAT-ET with transmembrane activity A 1 peptide obtained

[0038] Total RNA was extracted from SKOV3 cells, cDNA was obtained by reverse transcription, and ET was obtained by PCR using cDNA as a template A R carboxy-terminal polypeptide sequence, its upstream primer: Downstream primer 5'CGTCGGATCCGTTCATGCTGTCCTTATGGCT3'(SEQ ID NO.8) (penetrating peptide sequence in bold), insert TAT coding sequence into the upstream primer, add XhoI and BamHI restriction sites to the upstream and downstream primers respectively, link by restriction enzyme digestion method to construct pWaldo-TAT-ET A 1 Escherichia coli expression vector, and transformed into BL21 (DE3) expression strain to obtain the recombinant.

[0039] Inoculate the BL21(DE3) recombinant strain in 200ml LB medium and culture overnight at 37°C. Transfer 50ml overnight culture to 1L LB medium, culture to OD at 37℃ 600 Between about 0.5 and 0.6, add IPTG wit...

Embodiment 2

[0046] Example 2 Polypeptide TAT-ET A 1 Inhibition of migration and invasion of ovarian cancer cells

[0047] Cell migration and invasion: SKOV3 cell migration and invasion assays use a 24-well transwell cell culture chamber, and a polycarbonate filter membrane with 8 μm pores is placed in the chamber. Digest the cultured cells with trypsin (add 0.2 mg / mL TAT-ET before digestion A 1 polypeptide was treated for 2h) and resuspended in RPMI-1640 medium to make the final concentration 2×10 5 pieces / ml. 500 μL of 10% FBS / RPMI-1640 medium or 500 μL of SDF-1 solution was added to the bottom layer of the chamber, and 100 μL of cell suspension was added to the upper layer of the filter membrane.

[0048] For the invasion experiment, 50 μL of Matrigel gel diluted 1:1 in serum-free RPMI-1640 medium was spread in the Transwell chamber, and 400 μL of cell suspension was inoculated after incubation at 37°C for 2 hours.

[0049] After standing in a constant temperature incubator for 24 h...

Embodiment 3

[0053] Example 3 Polypeptide TAT-ET A 1 Inhibition of migration and invasion of colon cancer cells

[0054] Cell migration and invasion: The HCT8 cell migration and invasion assay uses a 24-well transwell cell culture chamber, and a polycarbonate filter membrane with 8 μm pores is placed in the chamber. Digest the cultured cells with trypsin (add 0.2 mg / mL TAT-ET before digestion A 1 polypeptide was treated for 2h) and resuspended in RPMI-1640 medium to make the final concentration 2×10 5 pieces / ml. 500 μL of 10% FBS / RPMI-1640 medium or 500 μL of SDF-1 solution was added to the bottom layer of the chamber, and 100 μL of cell suspension was added to the upper layer of the filter membrane.

[0055] For the invasion experiment, 50 μL of Matrigel gel diluted 1:1 in serum-free RPMI-1640 medium was spread in the Transwell chamber, and 400 μL of cell suspension was inoculated after incubation at 37°C for 2 hours.

[0056] After standing in a constant temperature incubator for 24 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses polypeptide having effect of resisting tumors and use of the polypeptide. The polypeptide is named as TAT-ETA1, is polypeptide as shown as (1) or (2): (1) polypeptide of the 12-69th amino acid residues of an amino acid sequence as shown in SEQ ID NO:1; and (2) polypeptid of an amino acid sequence as shown in SEQ ID NO:1. The polypeptide TAT-ETA1 provided by the invention isfrom the carboxyl terminal of A type endothelin receptor 1(ETAR), when the TAT-ETA1 can act on ETAR in endothelin 1, the TAT-ETA1 can be combined with the carboxyl terminal of the Beta-arrestin 1 (ETAR) competitively to interfere interact between ETAR and beta-arrestin 1 so as to relieve cancer cell migration, invasion induced by the beta-arrestin 1, reverse tolerance during chemotherapy and thelike. The polypeptide TAT-ETA1 has clinical application potential for treatment of cancer.

Description

technical field [0001] The invention relates to the technical field of medicine, in particular to a polypeptide with anticancer effect and its application. Background technique [0002] G protein-coupled receptor family proteins are the most common therapeutic targets, among which the endothelin axis is a key pathway in the occurrence and progression of cancer, and has become an important way to study cancer mechanism and clinical treatment. Endothelin contains three biologically active peptides, ET-1, ET-2 and ET-3. The most important ET-1 peptide can regulate cell proliferation, survival, and motility by specifically binding to the ET-1 receptor (ET-1R). , cytoskeletal changes, angiogenesis, metastasis, and chemotherapeutic drug resistance, while the ET-1R receptor has two subtypes: ET A Receptor (ET A R) and ET B Receptor (ET B R). ET A The research of R shows that its function is mainly mediated by the multifunctional scaffold protein β-arrestins, and the role of β...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K19/00C12N15/62C07K14/72C12N15/12A61K38/17A61P35/00
CPCA61K38/00A61P35/00C07K14/723C07K2319/10
Inventor 王中山张梦
Owner 伽柏康(海南)控股有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com