Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for building long-fragment target gene through polynucleotide kinase and application of method

A polynucleotide and long fragment technology, applied in the field of molecular biology, can solve the problems of increased economic burden, high price, high cost, etc., and achieve the effects of easy operation, easy purchase, and reduced economic burden.

Inactive Publication Date: 2019-08-09
WUHAN UNIV OF SCI & TECH
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] When many companies synthesize primers, if the customer has no special requirements, the 5' end of the primer will be dephosphorylated. Generally, the phosphorylated 5' end will be synthesized only when the customer requests it, and a higher fee will be charged. cost, which adds some economic burden to the already expensive sequence synthesis work

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for building long-fragment target gene through polynucleotide kinase and application of method
  • Method for building long-fragment target gene through polynucleotide kinase and application of method
  • Method for building long-fragment target gene through polynucleotide kinase and application of method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0026] S1: Segment the target gene sequence according to actual needs, and add restriction site sequences at both ends of each segment, and then synthesize the corresponding target product sequence fragments.

[0027] In this embodiment, the long-fragment phosphorylated target gene sequence to be constructed is divided into two sections, specifically:

[0028] 5'TCGAGGTCGACGGTATCGATAAGCTCGCTTCACGAGATTCCAGCAGGTCGAGGGACCTAATTAAGGGTTCCAAGCTTAAGC3' See SEQ ID NO:1.

[0029] 3'CCAGCTGCCATAGCTATTCGAGCGAAGTGCTCTAAGGTCGTCCAGCTCCCTGGATTAATTCCCAAGGTTCGAATTCGCCGG5' See SEQ ID NO:2.

[0030] And add restriction site sequences at both ends of each segment, such as figure 2 shown. Primers were designed for both ends of the sequence, synthesized in the form of primers, and then sent to a third-party Sangon Biotechnology Company for synthesis. The primer sequences are as follows:

[0031] 1F,5'TCGAGGTCGACGGTATCGATAAGCTCGCTTCACGAGATTCC3',见SEQ ID NO:3;2R,5'CCTGCTGGAATCTCGTGAAGCGAGCTTATCGAT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of molecular biology, and particularly relates to a method for building a long-fragment target gene through polynucleotide kinase and application of the method. The method for building the long-fragment target gene through the polynucleotide kinase can effectively reduce the economic cost generated when the target gene is built and reduce the probability of base mutation. The method is characterized by comprising the steps that the target gene sequence is fragmented according to actual requirements, enzyme cutting site sequences are added to the twoends of each fragment respectively, and then corresponding target product sequence fragments are synthesized; by using the oligonucleotides 5' end of the T4 polynucleotide kinase, the target productis phosphorylated; the phosphorylated target product is annealed to obtain target fragments; a carrier vector is subjected to enzyme cutting, the formed sticky ends correspond to the enzyme cutting site sequences, an enzyme cutting product is recycled, and carrier fragments are obtained; the target fragments are connected with the carrier fragments to obtain the connection product.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and in particular relates to a method for constructing a long fragment target gene by polynucleotide kinase and its application. Background technique [0002] The ligation of DNA fragments is catalyzed by DNA ligase. DNA ligase catalyzes the connection of adjacent bases between DNA fragments with blunt ends or complementary cohesive ends through 3' hydroxyl ends and 5' phosphate ends to form phosphodiester bonds. This reaction is an energy-requiring reaction, usually requiring the addition of ATP or NADH , the ligation efficiency of DNA ligase on cohesive ends is much higher than that on blunt ends. In genetic engineering experiments, the most commonly used ligase is T4 DNA ligase derived from T4 phage. It can be directly ligated for blunt ends or complementary cohesive ends. One fragment with blunt ends and the other with cohesive ends or both fragments with cohesive ends but not pa...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/63
CPCC12N15/63
Inventor 姚凯覃欢张士尧冯源张文良姚浩哲肖鹦王佳汝吴嘉轩
Owner WUHAN UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products