Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of mg132 as synergist and stabilizer in vaccine production

A technology of MG132 and synergist, applied in the field of biomedicine, can solve the problems of high production cost, low vaccine production efficiency, unsuitable for large-scale promotion, etc., and achieve the effect of promoting vaccine production and good vaccine stability

Active Publication Date: 2020-05-15
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, vaccines generally have shortcomings such as low production efficiency and poor stability.
Genetically engineered vaccines based on virus-like particles have been successfully used in the R&D and production of modern vaccines. However, genetically engineered vaccines usually use eukaryotic expression systems, which have high production costs and are not suitable for large-scale promotion.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of mg132 as synergist and stabilizer in vaccine production
  • Application of mg132 as synergist and stabilizer in vaccine production
  • Application of mg132 as synergist and stabilizer in vaccine production

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1 Effect of MG132 on the expression of FMDV structural protein VP3

[0029] 1.1 Experimental steps

[0030] (1) HEK-293T cells were plated in a 12-well plate, and co-transfected with pCDNA3.1-HA-TBK1 plasmid (0.25 μg) and pCDNA3.1-Flag-VP3 plasmid (1 μg) after 12 h;

[0031] (2) 18h after transfection, add DMSO (50μM, as control), MG132 (50μM), 3-MA (0.5mg / ml), NH 4 Cl (25mM), reacted for 6h;

[0032] (3) After the reaction was completed, the above samples were collected respectively, and after lysis with SDS-loading buffer, the expression of VP3 protein was detected by WB method.

[0033] 1.2 Experimental results

[0034] The result is as figure 1 shown, the expression of the FMDV structural protein VP3 was significantly increased after the addition of MG132, while the addition of DMSO, 3-MA and NH 4 Cl had no significant effect on the expression of structural protein VP3, indicating that only MG132 could increase the expression of VP3 protein.

Embodiment 2

[0035] Example 2 The effect of MG132 on the expression of structural proteins in FMDV-infected cells

[0036] 2.1 TBK1 - / - Construction of MEF

[0037] 2.1.1 Experimental steps

[0038] (1) Annealing coupling, mix the CRISPR / Cas9 F (CGGCGAGTCAACTCCGGCCA) and R (TGGCCGGAGTTGACTCGCCG) guide sequences (5 μL) at a concentration of 10 μM with 0.5 M NaCl (6 μL) and water (24 μL), and place the annealed primers into Put it in a 95°C water bath for 5min, then take it out and cool down to room temperature naturally;

[0039] (2) According to the instructions, use Fast Digest Bsm BI to cut the sticky ends of the pGL-U6-gRNA vector; mix 5 μL of the annealed primers and 2 μL of the digested vector with T4 ligase, and connect at room temperature for 30 min;

[0040] (3) Mix 5 μL of the ligation product with 50 μL of competent DH5α, heat shock for 30 seconds, and plate;

[0041] (4) Picking a single clone, sequencing, and extracting the plasmid, the obtained recombinant plasmid is pGL-U...

Embodiment 3

[0055] Example 3 Effects of MG132 on the Expression of Other Picornaviridae VP3 Proteins

[0056] 3.1 Experimental steps

[0057] (1) 293T cells were plated in 12-well plates, and transfected with pCDNA3.1-HA-TBK1 plasmid (0.25 μg), pCDNA3.1-EV71-Myc-VP3 plasmid (1 μg), and pCDNA3.1-EMCV-Myc after 12 hours - VP3 plasmid (1 μg), and pCDNA3.1-SVV-Myc-VP3 plasmid (1 μg);

[0058] (2) 18 hours after transfection, DMSO (50 μM, as a control) and MG132 (50 μM) were added for 6 hours;

[0059] (3) Collect samples and detect the expression of VP3 protein in each sample.

[0060] 3.2 Experimental results

[0061] Experimental results such as Figure 4 As shown, compared with DMSO, the expression levels of VP3 proteins of picornaviridae viruses EV71, EMCV and SVV were significantly increased after adding MG132.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biomedicine, and particularly relates to an application of MG132 as a vaccine production synergist and a stabilizing agent. The MG132 can increase the expressionlevel of ribonucleic acid virus structural protein VP3, further promotes the assembly of virus-like particles, and can be applied to virus-like particle expression synergists, virus-like particle production synergists and the stabilizing agents of related vaccines to promote vaccine production and improve vaccine stability.

Description

technical field [0001] The invention belongs to the field of biomedicine, in particular to the application of MG132 as a synergist and stabilizer for vaccine production. Background technique [0002] Picornaviridae is a family composed of the smallest groups of RNA viruses, mainly including Enterovirus, Rhinovirus, Cardiovirus and Aphthovirus. Foot-and-mouth disease (FMDV) is a single-stranded positive-stranded RNA virus, belonging to the genus Foot-and-mouth disease virus of the family Picornaviridae. , consisting of the structural proteins VP1-VP4. Outbreaks of foot-and-mouth disease can restrict trade in animals and their products, with serious economic and social consequences. [0003] At present, vaccination is an effective means to specifically prevent foot-and-mouth disease (FMD). Conventional vaccines such as FMD attenuated vaccine and inactivated vaccine have good immunogenicity and play an important role in the prevention and control of FMD. At present, vaccines...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N7/00C07K14/09C07K14/085A61K47/18
CPCA61K47/18C07K14/005C12N7/00C12N2770/32122C12N2770/32222C12N2770/32322
Inventor 郑海学李丹杨文萍张敬茹毅郝荣增张克山田宏曹伟军刘湘涛
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com