Application of mg132 as synergist and stabilizer in vaccine production
A technology of MG132 and synergist, applied in the field of biomedicine, can solve the problems of high production cost, low vaccine production efficiency, unsuitable for large-scale promotion, etc., and achieve the effect of promoting vaccine production and good vaccine stability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Example 1 Effect of MG132 on the expression of FMDV structural protein VP3
[0029] 1.1 Experimental steps
[0030] (1) HEK-293T cells were plated in a 12-well plate, and co-transfected with pCDNA3.1-HA-TBK1 plasmid (0.25 μg) and pCDNA3.1-Flag-VP3 plasmid (1 μg) after 12 h;
[0031] (2) 18h after transfection, add DMSO (50μM, as control), MG132 (50μM), 3-MA (0.5mg / ml), NH 4 Cl (25mM), reacted for 6h;
[0032] (3) After the reaction was completed, the above samples were collected respectively, and after lysis with SDS-loading buffer, the expression of VP3 protein was detected by WB method.
[0033] 1.2 Experimental results
[0034] The result is as figure 1 shown, the expression of the FMDV structural protein VP3 was significantly increased after the addition of MG132, while the addition of DMSO, 3-MA and NH 4 Cl had no significant effect on the expression of structural protein VP3, indicating that only MG132 could increase the expression of VP3 protein.
Embodiment 2
[0035] Example 2 The effect of MG132 on the expression of structural proteins in FMDV-infected cells
[0036] 2.1 TBK1 - / - Construction of MEF
[0037] 2.1.1 Experimental steps
[0038] (1) Annealing coupling, mix the CRISPR / Cas9 F (CGGCGAGTCAACTCCGGCCA) and R (TGGCCGGAGTTGACTCGCCG) guide sequences (5 μL) at a concentration of 10 μM with 0.5 M NaCl (6 μL) and water (24 μL), and place the annealed primers into Put it in a 95°C water bath for 5min, then take it out and cool down to room temperature naturally;
[0039] (2) According to the instructions, use Fast Digest Bsm BI to cut the sticky ends of the pGL-U6-gRNA vector; mix 5 μL of the annealed primers and 2 μL of the digested vector with T4 ligase, and connect at room temperature for 30 min;
[0040] (3) Mix 5 μL of the ligation product with 50 μL of competent DH5α, heat shock for 30 seconds, and plate;
[0041] (4) Picking a single clone, sequencing, and extracting the plasmid, the obtained recombinant plasmid is pGL-U...
Embodiment 3
[0055] Example 3 Effects of MG132 on the Expression of Other Picornaviridae VP3 Proteins
[0056] 3.1 Experimental steps
[0057] (1) 293T cells were plated in 12-well plates, and transfected with pCDNA3.1-HA-TBK1 plasmid (0.25 μg), pCDNA3.1-EV71-Myc-VP3 plasmid (1 μg), and pCDNA3.1-EMCV-Myc after 12 hours - VP3 plasmid (1 μg), and pCDNA3.1-SVV-Myc-VP3 plasmid (1 μg);
[0058] (2) 18 hours after transfection, DMSO (50 μM, as a control) and MG132 (50 μM) were added for 6 hours;
[0059] (3) Collect samples and detect the expression of VP3 protein in each sample.
[0060] 3.2 Experimental results
[0061] Experimental results such as Figure 4 As shown, compared with DMSO, the expression levels of VP3 proteins of picornaviridae viruses EV71, EMCV and SVV were significantly increased after adding MG132.
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com