Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A molecular marker, detection method and application related to pig muscle fiber area and intramuscular fat content

A technology of molecular markers and intramuscular fat, which is applied in biochemical equipment and methods, microbiological determination/inspection, DNA/RNA fragments, etc., can solve the problems of slow progress in candidate gene research, and achieve convenient and easy-to-operate detection methods, low cost effect

Active Publication Date: 2021-03-16
HUAZHONG AGRI UNIV
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although some progress has been made in the identification and application of candidate genes related to pork quality traits, the research on candidate genes related to muscle fiber traits and intramuscular fat content has been slow

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A molecular marker, detection method and application related to pig muscle fiber area and intramuscular fat content
  • A molecular marker, detection method and application related to pig muscle fiber area and intramuscular fat content
  • A molecular marker, detection method and application related to pig muscle fiber area and intramuscular fat content

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1 Nucleotide sequence cloning and SNP scanning of the first exon to the third exon region of TNNC2 gene

[0033] 1. Primer Design

[0034] Download the TNNC2 gene sequence of pig (Sscrofa11.1) from the ensembl database, GenBank accession number: NC_010445.4, wherein the DNA sequence from the first exon to the third exon region is as follows, and see SEQ ID NO: 1; Sequence Listing In the figure, the horizontal line indicates the sequence information of the PCR products amplified by subsequent experiments, the sequence in the box line is the sequence of the splice donor mutation detected in the subsequent experiment, and the arrow represents the insertion site of the insertion mutation detected in the subsequent experiment.

[0035]GACACGCAACCATGGTAAGGACGAGAGGGGATTTCATCCCTTTACTCGCCGGAGCACTTCTGGGCCAGATCCGGGTGCTCTGCAGGGCAGTAACTTGGATGTCTGAAGATGGACCCAGGCGTCTGGGAGGAAGCCCCAGAAGAAGGCCTTGGACTTGTCTTGGAAGGGGAGGGCTGGGACGTTCCAGGGCTTGACTCTCAAGGCATGCCTGTTCCCTGAGATCTTCGGAGGATTCC...

Embodiment 2

[0053] The detection method of embodiment 2 TNNC2 gene INDEL mutation

[0054] S1: Primer design. Specific primers were designed for the INDEL mutation present at the first exon of the TNNC2 gene as follows:

[0055]TNNC2_M1_F: 5'CCTATCGCCACCTTACTGTCAC 3', see SEQ ID NO:6;

[0056] TNNC2_M1_R: 5'CAGCTGAAGAATAATGCAATGC 3', see SEQ ID NO:7.

[0057] S2: PCR amplification, the total PCR reaction system is 10 μL, including 1 μL of porcine genomic DNA at a concentration of 50 ng / μL; 5 μL of 2×Taq PCR Mix; 0.2 μL of 10 mM forward and reverse specific primers; 3.6 μL The amplification conditions were: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s; annealing at 60°C for 30 s; extension at 72°C for 15 s; 35 cycles; stop extension at 72°C for 5 min; cooling at 15°C for 2 min. Among them, 2×Taq PCR Mix was purchased from Beijing Aidelai Biotechnology Co., Ltd. PCR products were detected by 1% agarose gel electrophoresis. Using primers TNNC2_M1_F and TNNC2_M1_R to...

Embodiment 3

[0061] Example 3 Detection of Genetic Diversity and Association Analysis with Characters

[0062] 1. Using the detection method for the TNNC2 gene INDEL mutation established in Example 2, in the three hybrid combinations (DLC, DDLC, DLLC) of the "Zhuangxiang black pig" population (Group 1) and the lean commercial hybrid population Polymorphism detection was carried out in the three cross combinations (PLY, DLY, PDLY) of (Group 2). The results are shown in Table 1.

[0063] Table 1 Allele frequency of INDEL mutation of TNNC2 gene in different populations

[0064]

[0065] The results showed that in the "Zhuangxiang black pig" group (Group 1), individuals with BB and AB genotypes were dominant, and individuals with AA genotype were less; Individuals with the genotype are dominant, and individuals with the BB genotype are less.

[0066] 2. In order to detect the existence of the INDEL mutation of the TNNC2 gene in different purebred individuals, collected Landrace, Yorkshir...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of molecular markers, particularly relates to a molecular marker related to pig muscle fiber area and intramuscular fat content, a detection method and application of the molecular marker, and aims to obtain a molecular marker related to pig muscle fiber area and intramuscular fat content, and establish a method for determining the pig muscle fiber areaand intramuscular fat content within a short time, thereby determining meat tenderness, and assisting in breeding. The technical scheme is as follows: a specific primer is designed according to the INDEL mutation site of the TNNC2 gene on the first exon, amplification is carried out, and the polymorphism detection is carried out on the site by using restriction endonuclease BsmAI, thus the size of the muscle fiber area and the intramuscular fat content between the pig individuals are distinguished according to the polymorphism detection results.

Description

technical field [0001] The invention belongs to the technical field of molecular markers, in particular to a molecular marker related to pig muscle fiber area and intramuscular fat content, a detection method and an application thereof. Background technique [0002] my country is a big country in pork production and consumption. For a long time, indicators such as pig growth rate, lean meat percentage, feed conversion efficiency and slaughter volume have been the focus of pig production. However, high-intensity selection for meat production has resulted in a substantial decline in meat quality. With the improvement of people's material living standards, high-quality and high-priced pork has gradually become the focus of consumers' choice, and the tenderness of meat is one of the important factors affecting consumers' choice. Therefore, genetic improvement of meat tenderness has gradually become An important research direction of breeding work. [0003] Existing studies hav...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6888C12Q1/6858C12N15/11
CPCC12Q1/6858C12Q1/6888C12Q2600/124C12Q2600/156C12Q2531/113C12Q2521/301C12Q2565/125
Inventor 徐学文马婷婷赵书红李新云谢胜松李小平刘小磊刘炎
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com