Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for obtaining non-transgenic storage-resistant fresh-eating lycium barbarum

A storage-resistant, goji berry technology, applied to other methods of inserting foreign genetic materials, genetic engineering, plant genetic improvement, etc., can solve the problems of short fruit supply period and shelf life, high risk, and difficulties, and reduce the number of population samples , reduce safety risks, and shorten the breeding cycle

Active Publication Date: 2019-07-12
TIANJIN GENOVO BIOTECH CO LTD
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the fresh wolfberry fruit is a berry with a water content as high as 80% and is rich in sugar. The fruit deteriorates quickly after harvesting and is easy to rot easily. The supply period and shelf life of the fruit are very short, making it difficult to meet market demand.
Although thin skin and thick meat improve the taste, it increases the difficulty of storage and transportation
Makes the sales cost of wolfberry fresh fruit very high, and the risk is extremely high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for obtaining non-transgenic storage-resistant fresh-eating lycium barbarum
  • Method for obtaining non-transgenic storage-resistant fresh-eating lycium barbarum
  • Method for obtaining non-transgenic storage-resistant fresh-eating lycium barbarum

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] Example 1, Cloning of Lycium barbarum LbPL gene and determination of target sequence

[0060] 1. Cloning of Lycium barbarum LbPL gene

[0061] The full-length cDNA of Lycium barbarum pectin lyase LbPL gene was amplified by RT-PCR using the cDNA obtained by reverse transcription of the total RNA of Lycium barbarum leaves as a template. Design of primers based on the conserved sequence of tomato PL gene in Solanaceae

[0062] F:ATGGG(G / C)CACTTCCTCTGTTTT

[0063] R:TT(T / C)AGCAACGAGAACCCTTTTAC

[0064]Amplify with primer combination F / R, RT-PCR result obtains the fragment of 1212bp through sequencing ( figure 2 ), which is a complete open reading frame, encoding 403 amino acids. Through Blast comparison, the gene represented by it was named LbPL according to the homology.

[0065] The genome DNA sequence of the LbPL gene is sequence 1, the cDNA sequence is sequence 2; the amino acid sequence of the protein LbPL encoded by the gene is sequence 3.

[0066] 2. Selection...

Embodiment 2

[0073] Embodiment 2, the knockout of LbPL gene

[0074] 1. Preparation of Cas9 protein and sgRNA transcribed in vitro

[0075] 1. Preparation of Cas9 protein

[0076] The purified Cas9 protein (amino acid sequence is sequence 11) was obtained from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences.

[0077] 2. In vitro transcription of target site sgRNA

[0078] The target sequence of sgRNA-1 is Target-LbPL1: 5'-GGGTATTTATCGTGTGGTACCGG-3' (SEQ ID NO: 7)

[0079] 1), construction of recombinant plasmid

[0080] Synthesize the following single-stranded primers with sticky ends (underlined parts): LbPL1F: 5'-ATTGGGGTATTTATCGTGTGGTAC-3'; LbPL1R: 5'-AAACGTACCACACGATAAATACCC-3', which form double-stranded DNA with sticky ends through the primer annealing procedure;

[0081] Then insert the double-stranded DNA with cohesive ends into the pHSE401 vector (recorded in the following literature: A CRISPR / Cas9toolkit for multiplex genome editing in plants....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for obtaining non-transgenic storage-resistant fresh-eating lycium barbarum. The method for cultivating the storage-resistant fresh-eating lycium barbarum includes thesteps of inhibiting the expression of a pectate lyase gene in target lycium barbarum to make the lycium barbarum resistant to storage, or inhibiting the content or activity of pectate lyase in the target lycium barbarum to make the lycium barbarum resistant to storage. The nutritional value of fresh lycium barbarum fruit is much higher than that of dried fruit, but the short shelf life is the main reason for limiting the sales of the fresh fruit. Compared with a traditional breeding technology, the method can quickly obtain the new variety resistant to storage.

Description

technical field [0001] The invention belongs to the field of biotechnology breeding, and relates to a method for obtaining non-transgenic storage-stable fresh-eating wolfberry, in particular to a method for obtaining a storage-stable breeding material of wolfberry by using genome editing technology to mutate Ningxia wolfberry pectin lyase-related genes. Background technique [0002] Lycium barbarum L. is an important medicinal plant resource in my country. Contains Lycium barbarum polysaccharide, betaine, Lycium barbarum pigment, etc. Modern medicine proves that Lycium barbarum has extensive medicinal value. In addition, wolfberry is resistant to drought and suitable for growth in sandy land, so it can be used as a shrub for water and soil conservation, and because of its salt-alkali tolerance, it has become a pioneer in the development of trees in saline-alkali land. [0003] The various nutritional components of fresh wolfberry fruit are higher than that of dried fruit, a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82C12N15/90C12N15/60C12N15/56C12N15/55C12N15/113A01H5/00A01H6/82
CPCC12N15/8213C12N15/902C12N9/88C12N9/2408C12N9/18C12N15/113C12Y301/01011C12Y302/01015C12Y402/02002C12N2810/10C12N2310/10C12N2310/20
Inventor 张康高崑冉毅东
Owner TIANJIN GENOVO BIOTECH CO LTD
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More