Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Bovine-derived component detection kit

A component detection and kit technology, applied in the field of bovine-derived component detection kits, can solve the problem of time-consuming, labor-intensive and high cost, and achieve the effects of improving sensitivity and accuracy, complete inspection objects, and simple operation.

Active Publication Date: 2019-05-14
兰天恩 +1
View PDF7 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of the present invention is to overcome the time-consuming, labor-intensive and high-cost defects of the prior art, and provide a bovine-derived component detection kit with simple operation, fast sensitivity, large detection throughput, visualized detection results, and low cost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bovine-derived component detection kit
  • Bovine-derived component detection kit
  • Bovine-derived component detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] The bovine-derived component detection kit of this example consists of a primer combination and a membrane chip, and is characterized in that the primer combination is a 4-fold polymerase chain reaction (PCR) primer combination. The 'end was modified with biotin, and the base sequence of each pair of primers 5'-3' is as follows:

[0043] 16S rRNA: forward primer: GACCTCGATGTTGGATCAGGAC

[0044] Reverse primer: GATAGAAACCGACCTGGATTG

[0045] Cattle D-loop: forward primer: AACACAGAATTTGCACCCT

[0046] Reverse primer: ATTAAGCTCGTGATCTAATGGT

[0047] Buffalo D-loop: forward primer: CTGACTTTACACTCTAGCCTA

[0048] Reverse primer: GGATTTGACTTGAATGCACT

[0049] Yak D-loop: forward primer: CTAACAACACACATCCCCAA

[0050] Reverse primer: TTAAGCTCGTGATCTAGTGGA

[0051] The membrane chip consists of 4 sets of probe sequences and a set of positive control (Positive) probe sequences fixed on the surface of the support membrane in sequence. The 5' end of the probe needs to be modi...

Embodiment 2

[0081] The bovine-derived component detection kit in this example consists of a primer set, a membrane chip, and auxiliary materials. Oligonucleotide single-stranded DNA, the base sequence of positive oligonucleotide single-stranded DNA with biotin mark at the 5' end is biotin-5'-CTGGTACTTTGGA

[0082] CACTCGTTCTTCTCGCACTGCTCATTATTGCTTCTGATCTGGATGC-3'.

[0083] The extracted bovine-derived component DNA is yellow cattle, and the test results are as follows figure 2 Shown in B.

[0084] All the other are the same as embodiment one.

Embodiment 3

[0086] The bovine-derived component DNA extracted in this example is buffalo, and the test results are as follows: image 3 Shown in B.

[0087] All the other are with embodiment two.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a bovine-derived component detection kit, and belongs to the technical field of detection articles, the bovine-derived component detection kit consists of a primer combinationand a membrane chip, and is characterized in that the primer combination is a four-fold PCR primer combination, each pair of primers is a yellow cattle D-loop, a buffalo D-loop, a yak D-loop and an endogenous gene sequence 16 S rRNA, the membrane chip comprises four groups of probe sequences and a group of positive control probe sequences which are sequentially fixed on the surface of a supporting membrane, wherein the probe sequences are a yellow cattle D-loop probe, a buffalo D-loop probe, a yak D-loop probe, a 16 S rRNA probe and a Positive probe respectively; an asymmetric PCR amplification primer is arranged in the primer combination, which is the primer with a biotin marker at the 5' end. The bovine-derived component detection kit overcomes defects of time and labor waste and high cost in the prior art, and the operation of the provided bovine-derived component detection kit is simple, fast and sensitive, the detection flux is large, the detection result is visible and the costis low.

Description

technical field [0001] The invention relates to the field of detection supplies, in particular to a bovine-derived component detection kit. Background technique [0002] With the increase of the income of urban and rural residents in China and the improvement of living standards, beef has become one of the main meat products in my country. From 2000 to 2016, domestic beef consumption increased from 5.102 million tons to about 7.59 million tons, making China the third largest beef consumer in the world. There are three types of cattle produced in China: cattle, buffaloes and yaks. Cattle are produced all over the country, mainly in the plains; buffaloes are produced in the south of my country, mainly in the Jiangnan region; yaks are produced in the northwest plateau, mainly in the Qinghai-Tibet Plateau. Among them, the yak is a unique semi-wild and semi-primitive animal because it grows in the high cold and has no polluted environment, and its nutritional value and market va...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6888
Inventor 兰天恩仝伟建许敬东祖新杨晓楠段鹏郭渊清吴礼娥李羽翡郭锌
Owner 兰天恩
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com