SNP Molecular Markers Linked to Wheat Stripe Rust Resistance Gene qyr.sicau-1b-1 and Its Application
A molecular marker and stripe rust technology, applied in the field of molecular biology and crop genetics and breeding, can solve the problems of grain failure, necrotic spots, inability to perform photosynthesis, etc., achieve high success rate, high accuracy, and improve selection and identification efficiency Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Example 1 Obtaining of Wheat Stripe Rust Resistance Gene QYr.sicau-1B-1 and Its Molecular Marker KASP-Yr
[0044] (1) Using the wheat line '20828' as the female parent and the wheat variety 'CN16' as the male parent, the hybrid F 1 , F 1 F 2 , at F 2 Using the single-ear transmission method, all the way to F 8 Generations, recombinant inbred lines containing 199 lines were obtained to form a genetic mapping population.
[0045] (2) Identification of stripe rust phenotype in the recombinant inbred line population. When the induced material SY95-71 is fully morbid, the disease resistance response of the test material is recorded in the field, and the response type is classified according to the 1-9 classification standard for each strain in the population. Judgment was carried out, and the judgment result was recorded as the morphological marker data of the stripe rust resistance gene QYr.sicau-1B.1. In this way, the location located on the linkage map is the locatio...
Embodiment 2
[0052] Example 2 Application of Molecular Marker KASP-Yr in Selection and Control of Stripe Rust Resistance QTL QYr.sicau-1B.1
[0053] (1) The common wheat line '20828' resistant to stripe rust was used as the female parent, and the common wheat line 'SY95-71' susceptible to the disease was used as the male parent to construct recombinant inbred lines, and 163 lines were randomly selected from the offspring lines.
[0054] (2) Carry out KASP-Yr marker detection on the obtained 163 strains, the specific method is: extract the DNA of 163 strains; use it as a template, and perform PCR with the specific primer pair of molecular marker KASP-Yr as primers Amplify and carry out fluorescence reading value, described labeled KASP-Yr primer is:
[0055] Primers on the FAM tag: (the underlined part is the FAM tag sequence)
[0056] 5'- GAAGGTGACCAAGTTCATGCT CTTGTGTGTGACTGTACCATA-3' (SEQ ID No. 1)
[0057] Primers on the HEX tag: (the underlined part is the HEX tag sequence)
[0058...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com