CGMMV (cucumber green mottle mosaic virus) induced gene silencing vector as well as building method and application thereof
A green mottled flower, gene silencing technology, applied in the direction of genetic engineering, biochemical equipment and methods, using vectors to introduce foreign genetic material, etc., to achieve the effect of reducing the expression level
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Construction of the VIGS vector mediated by embodiment 1.CGMMV
[0042] (1) Using the full-length invasive clone of CGMMV (PXT1-CGMMV) as a template, PCR amplification was performed with primers CP-TC-F and CP-TC-R, so that the CP start codon ATG was changed to ACG, and the PCR product It was recovered, and then transformed into E. coli competent Top10, and three positive clones were selected for sequencing verification, and the extracted plasmid with the correct sequencing result was taken and named as PXT1-CGACG. The primer sequences are as follows:
[0043] CP-TC-F:5'-CTGTTTCTTTTGAAGACGGCTTACAAT-3'
[0044] CP-TC-R: 5'-CGTCTTTCAAAAGAAACAGAACTGGACTC-3'.
[0045](2) The primers PXT1-F / 78B-99-R and PXT1-R / 78B-99-F were respectively used to amplify PXT1-CGACG and PXT1-CGMMV as templates. DNA fragment 1 containing CGMMV nt1-5840 (GenBank accession: KY753929) and DNA fragment 2 containing CGMMV nt5651-6423 were obtained respectively, see figure 1 . The primer sequence...
Embodiment 2
[0051] Example 2. Cloning and insertion of target gene fragments
[0052] (1) RNAsimple total RNA kit (Tiangen Biotech, Beijing, China) was used to extract total RNA from leaf tissues of Cucurbitaceae plants (watermelon, muskmelon, cucumber and gourd), and then Oligo dT primers, PrimeScript II reverse transcriptase ( TAKARA) to synthesize first-strand cDNA for RT-PCR by reverse transcription.
[0053] (2) A phytoene desaturase (PDS) gene forming a β-carotene synthesis pathway was selected as a target gene. Four pairs of primers were designed to amplify four PDS genes with different length fragments by referring to the known sequence information of Cucurbitaceae PDS genome in the NCBI database and combining the sequence information of the constructed vector. The primer sequences are as follows:
[0054] 78-69P-X:GAGTGGATGAGACTCTTGCACAGTTAAATTATCTTGAGCCTCCAGTTATAGGTCTAGGTC
[0055] 78-69P-S:GAGTCTCATCCACTCTTGCACAGTTAAATTATCTTGAGCCTCCATTAAGTAAAGTCCTG
[0056] 78-213-F: CCCGTC...
Embodiment 3
[0064] Example 3. Agrobacterium transformation of recombinant vector and its inoculation verification
[0065] (1) Add 5 μL of vector plasmids (CGMMV-BamHI-PDS69, CGMMV-BamHI-PDS150, CGMMV-BamHI-PDS213 and CGMMV-BamHI-PDS300) into 50 μL of GV3101 competent cells, let stand on ice for 10 min, and Quick-freeze in liquid nitrogen for 5 minutes, warm in a 37°C water bath for 5 minutes, and place on ice for 2 minutes. Place 500 μL of LB liquid medium without antibiotics in a shaker at 28°C and 200 rpm for 2 h, then centrifuge at 12,000 rpm for 1 min, collect the bacteria, and spread it on a medium containing antibiotics (50 ng / μl Kan , 50ng / μl Rif) on LB solid medium. After 48 hours, single cells were picked from the plate and cultured overnight in 200 μl LB liquid medium containing antibiotics (50ng / μl Kan, 50ng / μl Rif) to screen for positive clones.
[0066] (2) Put the screened positive clones and LB liquid medium containing antibiotics (50ng / μl Kan, 50ng / μl Rif) at a ratio of...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap