Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Promoter library and method for constructing expression system with different strengths in bacteria by using same

An expression system and promoter technology, applied in the field of promoter library, can solve the problem of unclear identical performance, etc., and achieve the effect of excellent expression efficiency

Active Publication Date: 2018-12-11
BLUEPHA CO LTD
View PDF4 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] The construction of the existing promoter library only involves the characterization and use in a certain type of bacteria, such as the promoter library constructed in Escherichia coli, it is not clear whether it has the same expression in other bacteria (strong weak ties and multiple ties)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Promoter library and method for constructing expression system with different strengths in bacteria by using same
  • Promoter library and method for constructing expression system with different strengths in bacteria by using same
  • Promoter library and method for constructing expression system with different strengths in bacteria by using same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1: Construction of an expression system containing a promoter library in Escherichia coli

[0040] The sequence of the promoter region was synthesized by Suzhou Synbio, in which the core sequence (ie -35box to the transcription start site) was two BsaI restriction sites, which could be replaced by any sequence. The synthesized sequence corresponds to SEQ ID NO: 1 (agcggataacaatttcacacaggaatgcctccacaccgctcgtcacatcctggagacctcactggaatcccagtatatagactttgacctgggtctcagctgtcaccggatgtgctttccggtctgatgagtccgtgaggacgaaacagcctctacaaataattttgtttaa).

[0041]The sequence synthesized above was amplified with primers and recovered, while PCR amplified the pSEVA321 plasmid containing the sfGFP gene (Silva-Rocha, R., de Lorenzo, V., 2013. The Standard European Vector Architecture (SEVA): acoherent platform for the analysis and deployment of complexprokaryoticphenotypes.NucleicAcidsRes.41,666–675.) as the vector backbone, and the two fragments were ligated with Gibson Assembly (pur...

Embodiment 2

[0152] Example 2: Construction of an expression system containing a promoter library in halophilic bacteria

[0153] The plasmids of the above-mentioned promoter library were respectively transformed into Escherichia coli S17-1 (ATCC number: 47055, which can be purchased from the American Type Culture Collection), and then transformed by using conjugation (Fu XZ, Tan D, Aibaidula G, Wu Q, Chen JC, Chen GQ (2014) Development of Halomonas TD01as a host for open production of chemicals. Metab Eng 23:78–91) Transfer the plasmid of the promoter library into Halomonas sp. Culture Collection Center, collection number CGMCC4353), to obtain an expression system containing a promoter library in halophilic bacteria.

[0154] After the halophilic bacteria were cultured in 60LB medium for 12 hours, the fluorescence intensity was detected by flow cytometry. The fluorescence intensity ranged from the 2nd power to the 5th power of 10. The results were as follows Figure 4 .

[0155] Take th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a promoter library and a method for constructing an expression system of the promoter library with different expression strengths in bacteria by using the promoter library. The promoter library comprises a promoter sequence as shown in SEQ ID NO:2 or SEQ ID NO:3, wherein n represents any one of a, t, c and g. The promoter library provided by the invention can be used in various bacteria such as escherichia coli and halophilic bacteria, has consistent expression strength between different bacteria, can be used as a basic genetic element, is used for fine regulation of genetic expression and metabolic pathways and has broad application prospects.

Description

technical field [0001] The invention relates to a promoter library and a method for using it to construct an expression system of the promoter library with different expression strengths in bacteria. Background technique [0002] In the fermentation industry, the transformation of industrial microorganisms is one of the basic methods to improve fermentation efficiency, obtain new products, and reduce fermentation costs. The purpose of transformation is mainly to increase the growth rate of microorganisms, increase the expression efficiency of microorganisms, and improve the conversion rate of products. Therefore, constructing a stable and efficient expression system in the strain has become an effective means to achieve this goal. [0003] The promoter is one of the core parts in the expression system. Fine regulation of the expression strength of the promoter can realize the optimization of the biosynthetic pathway and its product conversion rate. To this end, a series o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C40B40/06C40B50/06C12N15/113C12N15/70C12N15/74
CPCC12N15/70C12N15/74C40B40/06C40B50/06C07K14/195C07K14/245
Inventor 相瑞娟李腾
Owner BLUEPHA CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com