Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Dual fluorescence quantitation method for MO (mycoplasma ovipneumonia) and Mmc (Mycoplasma mycoides subsp.capri)

A Mycoplasma pneumoniae, dual fluorescence technology, applied in biochemical equipment and methods, microorganism-based methods, recombinant DNA technology, etc., to achieve the effects of cost saving, strong specificity, and simple operation

Inactive Publication Date: 2018-11-16
INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The technical problem to be solved by the present invention is to provide a method based on application-specific primers that can quickly, accurately and simultaneously detect the limitations of the existing two pathogen single PCR, double PCR and single fluorescent quantitative PCR detection technologies. Dual fluorescence quantitative PCR method for mycoplasma

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Dual fluorescence quantitation method for MO (mycoplasma ovipneumonia) and Mmc (Mycoplasma mycoides subsp.capri)
  • Dual fluorescence quantitation method for MO (mycoplasma ovipneumonia) and Mmc (Mycoplasma mycoides subsp.capri)
  • Dual fluorescence quantitation method for MO (mycoplasma ovipneumonia) and Mmc (Mycoplasma mycoides subsp.capri)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] A dual fluorescence quantitative PCR method for Mycoplasma ovipneumoniae and Mycoplasma mycoplasma goat subspecies, including:

[0059] (1) Design and synthesis of primers and probes:

[0060] According to the Mo p113 gene and Mmc MLC_1770 gene sequence published on GenBank, using Beacon Designer7.9 software, combined with NCBI Blast online analysis, two pairs of specific primers and probes for Mo and Mmc were designed to detect Mycoplasma ovis pneumoniae. The sequences of specific primers and probes are:

[0061] Upstream primer Mo-F: 5’-CTTCGGGACTTATTGGAG-3’;

[0062] Downstream primer Mo-R: 5’-GATGCAAACTGATTTACTTG-3’;

[0063] Fluorescent probe Mo-P: 5’-FAM- AAGACCGATTGTCAGGCCGA -Eclipse-3’;

[0064] The sequences of specific primers and probes designed to detect Mycoplasma mycoplasma goat subspecies are:

[0065] Upstream primer Mmc-F: 5’-CTAGCTAGCATAGTTGTTG-3’;

[0066] Downstream primer Mmc-R: 5’- GCTTGAACAACTATATTGTA -3’;

[0067] Fluorescent probe Mmc-P: 5’-TET-TAACACAGTTAAA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a dual fluorescence quantitation PCR (polymerase chain reaction) method for MO (mycoplasma ovipneumonia) and Mmc (Mycoplasma mycoides subsp.capri). A pair of specific detectionprimers Mo-F and Mo-R and a fluorescent probe Mo-P for MO as well as a pair specific detection primers Mmc-F and Mmc-R and a fluorescent probe Mmc-P for Mmc are designed respectively, and concentrations of the specific primers and corresponding fluorescent probes for the dual fluorescence quantitation PCR method for MO and Mmc are determined. Two kinds of mycoplasmas of MO and Mmc can be detectedand identified simultaneously with the dual fluorescence quantitation PCR method; the method has the advantages of rapidness, accuracy, high specificity, good repeatability and the like, can save cost, and is suitable for providing effective means for rapid detection and epidemiological investigation of caprine mycoplasmal pneumonia caused by the two kinds of mycoplasmas.

Description

Technical field [0001] The invention relates to a double fluorescent quantitative PCR method for Mycoplasma ovipneumoniae and Mycoplasma mycoplasma goat subspecies, and belongs to the technical field of biological detection. Background technique [0002] In recent years, Mycoplasma ovine pneumonia has been prevalent in Xinjiang, Liaoning, Hebei, Sichuan, Chongqing, Guangxi, Guizhou, Hunan, Fujian and other provinces in China. The main pathogens are Mycoplasma ovipneumonia (Mo) and Mycoplasma mycoplasma goat. Species (Mycoplasma mycoides subsp.capri, Mmc). In recent years, many scholars have reported that there are two or more mycoplasma mixed infections in the same sheep. However, the clinical symptoms caused by these two pathogens are similar, and the pathological changes are similar. It is difficult to distinguish clinically, which brings great significance to the diagnosis of the disease. Great difficulty. These two pathogens are the main epidemic diseases in the current she...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/689C12Q1/6851C12Q1/06C12N15/11C12R1/35
CPCC12Q1/6851C12Q1/689C12Q2600/16C12Q2531/113C12Q2537/143C12Q2563/107
Inventor 林裕胜胡奇林江锦秀张靖鹏游伟
Owner INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com