Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A snp marker primer and its application of scab resistance related gene tarlk-b

A wheat scab and marker technology, applied in the field of molecular genetic breeding, can solve problems such as scab, decline, and susceptible wheat, and achieve the effect of high efficiency and accuracy and stable technology

Active Publication Date: 2021-03-30
NANJING AGRICULTURAL UNIVERSITY +2
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

During the flowering and grain filling period of wheat, the climate is often warm, humid and rainy, and it is easy to be infected with wheat scab (Fusarium head blight, FHB), which leads to severe reduction in wheat yield and processing quality. The diseased wheat grains contain trichothecenes that can cause human and animal poisoning. Mycocene Mycotoxins Seriously Threaten Wheat Production Safety

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A snp marker primer and its application of scab resistance related gene tarlk-b
  • A snp marker primer and its application of scab resistance related gene tarlk-b
  • A snp marker primer and its application of scab resistance related gene tarlk-b

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1 Clone TaRLK-B in the disease-resistant variety Wangshuibai and the susceptible variety Alondra's respectively, and compare the sequence differences

[0026] Specific primers (TaRLK-F: ATGGCTGTGGTGAGTGCCTCTT (SEQ ID NO.5); TaRLK-R: TCACCTGGGGCCTGATAC (SEQ ID NO.6)) were designed according to the published Chinese spring sequence, and TaRLK sequences on chromosomes 3A, 3B, and 3D were cloned and sequenced After comparison, it was found that the full length of TaRLK-A was 1422bp, encoding 473 amino acids; the full length of TaRLK-B was 1143bp, encoding 380 amino acids; the full length of TaRLK-D was 1434bp, encoding 478 amino acids. Compared with 1139-1142bp (TGGA) TaRLK-D and 1224-1227bp (TGGA) TaRLK-A, the 1130-1132bp (TGA) homologous allele of TaRLK-B lacks a 'G' base, resulting in TaRLK -B terminates early at 1141-1143bp ( figure 1 ).

Embodiment 2

[0027] Embodiment 2, the design of SNP molecular marker primer

[0028] Comparison of TaRLK-B sequences in Wangshuibai and Alondra's revealed that there are several other SNPs ( figure 2). Teta-primer ARMS-PCR primers were designed according to Wang Shuibai and Alondra's SNP at the 233bp position in TaRLK-B ( image 3 ),

[0029] The sequence information of the designed four-primer combination is as follows:

[0030] outer primer 1: TGGACTCCATTGTCATTGGCAGGAGCAA (SEQ ID NO. 1);

[0031] outer primer2:TCCTCCTCCTCCATCTCATGATGCCACTG (SEQ ID NO.2);

[0032] inner primer 1: GCACCCCCACCGAAGGTAACACCGAC (SEQ ID NO.3);

[0033] Inner primer 2: ATAGGTGCAGGCAGATCACTTGGGGGCA (SEQ ID NO.4).

[0034] Embodiment 2, the realization of SNP molecular marker method

[0035] Use the above four primer combinations to perform PCR amplification detection in Wangshuibai and Alondra's. The results showed that polymorphic bands were amplified in the parents, in which a specific amplification ba...

Embodiment 3

[0038] Embodiment 3, the application of SNP molecular marker primer in recombinant inbred line (RIL) population, 22 natural populations

[0039] Further using this marker to amplify in other 20 wheat genotypes, it was found that the same band pattern as Wangshuibai was amplified in 5 materials including Sumai 3, early wheat, early fire head, Mianyang 11 and Chinese spring. There are 14 white shell cocoon heads, copper column heads, cocoon heads, fire heads, red shell cocoon heads, red head wheat, monk wheat, Yannong 19, Jimai 22, Ningmai No. 6, Taiwan wheat, Yangmai 158, and Mianyang 8545. The material was amplified with the same band type as Alondra's, and two genotypes ( Figure 5 ). The gene marker has obvious correlation in resistant and susceptible varieties. The SNP primer combination is completely consistent with the amplification result of the HRC marker ( Figure 5 ). Therefore, this marker can not only specifically identify TaRLK-B, but also specifically track th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an SNP marker primer of a scab-resistant related gene TaRLK-B and application thereof. A primer combination for tracking an SNP marker of a disease-resistant candidate gene TaRLK-B of wheat scab-resistant Fhb1 consists of sequences shown in SEQ ID NO. 1-4. PCR amplification is performed in Wangshuibai and Alondra's respectively to obtain two genotypes, which can be used asan SNP marker for the TaRLK-B gene. In the mapping population and the natural population, the label analysis and the disease resistance linkage or association analysis are performed to evaluate the application value of the marker in breeding resistance, thereby indicating that not only TaRLK-B can be specifically identified, but also the scab-resistant gene Fhb1 on 3BS can be specifically tracked.

Description

technical field [0001] The present invention belongs to the field of molecular genetic breeding, announces a single nucleotide site polymorphism (SNP) of a disease-resistant candidate gene TaRLK-B based on Fhb1, and develops a molecular marker of SNP functional type, which can be used for selection in production. TaRLK-B, a gene related to scab resistance. Background technique [0002] Wheat is the food crop with the largest planting area in the world and one of the most important food sources for human beings. During the flowering and grain filling period of wheat, the climate is often warm, humid and rainy, and it is easy to be infected with wheat scab (Fusarium head blight, FHB), which leads to severe reduction in wheat yield and processing quality. The diseased wheat grains contain trichothecenes that can cause human and animal poisoning. Mycocene mycotoxins seriously threaten the safe production of wheat. In my country, wheat areas in the middle and lower reaches of t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 肖进刘玉张婷王海燕袁春霞李子昂夏中华别同德王秀娥
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com