A kind of ammonium-resistant nitrogen-fixing microorganism overexpressing glnr gene and its construction method and application

A nitrogen-fixing microorganism and overexpression technology, applied in the field of microorganisms, can solve the problems of soil acidification, salinization, soil microbial activity decline, etc., and achieve the effect of improving nitrogenase activity, breaking through inhibition, and wide application prospects.

Active Publication Date: 2021-04-27
CHINA AGRI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, long-term excessive application of chemical nitrogen fertilizers leads to soil acidification and salinization, and the decline of soil microbial activity has become an important factor restricting the sustainable development of agriculture.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of ammonium-resistant nitrogen-fixing microorganism overexpressing glnr gene and its construction method and application
  • A kind of ammonium-resistant nitrogen-fixing microorganism overexpressing glnr gene and its construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] 1. Construction of a nitrogen-fixing Paenibacillus strain overexpressing the glnR gene

[0033] (1) Primers and vectors

[0034] glnR-amyE1: CGGCCACGATGCGTCCGGCGTAGAGGATCCGTT GTGGTAGGTGCATACG;

[0035] glnR-amyE2: ATGCTCTGGTCCAGTATTTTATCCGCTTCCTGG;

[0036] glnR-amyE3:AGCGGATAAATACTGGACCAGAGCATCTAATTG;

[0037] glnR-amyE4: ATTTGAGCATTGCGGCAACCTTATACCAAGAG;

[0038] glnR-amyE5: GTATAAGGTTGCCGCAATGCTCAAATCAACTC;

[0039] glnR-amyE6:GACTGCGCAAAAGACATAATCGATAAGCTTATTCATACAAGCCGCTCC.

[0040] pRN5101: Thermosensitive Shuttle Plasmid, Em R , presented by Professor Peng Qi, Institute of Plant Protection, Chinese Academy of Agricultural Sciences.

[0041] (2) Using primers glnR-amyE1 and glnR-amyE2, using the Paenibacillus polymyxa WLY78 genome as a template PCR amplification to obtain a 1161bp upstream homology arm of the amyE site; using primers glnR-amyE5 and glnR-amyE6, using the Paenibacillus polymyxa WLY78 genome The downstream homology arm of the amyE site with a ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the field of microorganisms, and specifically discloses an ammonium-resistant nitrogen-fixing microorganism overexpressing a glnR gene, a construction method and application thereof. The ammonium-resistant nitrogen-fixing microorganism integrates the glnR gene from Paenibacillus polymyxa at the amyE site of the Paenibacillus strain genome, and the ammonium-resistant nitrogen-fixing microorganism can perform biological nitrogen fixation under ammonium-limited and high-ammonium conditions, improving the The nitrogenase activity of Paenibacillus microorganisms under high ammonium conditions breaks through the inhibitory effect of high ammonium conditions on biological nitrogen fixation, and has broad application prospects in agricultural production.

Description

technical field [0001] The invention relates to the field of microorganisms, in particular to an ammonium-resistant nitrogen-fixing microorganism overexpressing a glnR gene and its construction method and application. Background technique [0002] Nitrogen is the largest element necessary for plant production. Chemical nitrogen fertilizer plays a very important role in ensuring my country's grain production, vegetable planting and fruit tree cultivation. However, long-term excessive application of chemical nitrogen fertilizers leads to soil acidification and salinization, and the decline of soil microbial activity has become an important factor restricting the sustainable development of agriculture. [0003] At normal temperature and pressure, nitrogen-fixing microorganisms can use the nitrogenase enzyme in the body to reduce nitrogen in the air to ammonium for plant growth and use. However, the efficiency of nitrogen fixation is affected by the concentration of ammonium, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/21C12N15/74C12R1/01
CPCC07K14/195C12N15/74
Inventor 陈三凤王天舒赵喜云
Owner CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap