Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Engineering bacterium for efficiently expressing recombinant ChIFN-alpha

An alpha interferon, high-efficiency expression technology, applied in the direction of interferon, cytokine/lymphokine/interferon, genetic engineering, etc., can solve the problem of high production cost and achieve the effect of high-efficiency expression and purification

Inactive Publication Date: 2018-06-29
SOUTH CHINA AGRI UNIV
View PDF2 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are few poultry recombinant interferon products on the market at present, and the production cost is relatively high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Engineering bacterium for efficiently expressing recombinant ChIFN-alpha
  • Engineering bacterium for efficiently expressing recombinant ChIFN-alpha
  • Engineering bacterium for efficiently expressing recombinant ChIFN-alpha

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0024] The preferred embodiments of the present invention will be described below in conjunction with the accompanying drawings. It should be understood that the preferred embodiments described here are only used to illustrate and explain the present invention, and are not intended to limit the present invention.

[0025] An engineering bacterium for highly expressing recombinant chicken interferon alpha, which comprises the following steps:

[0026] S1. According to the codon preference of Escherichia coli, the chicken alpha interferon gene sequence (AB021154) published in Genebank was codon optimized, and the optimized gene was synthesized by Yingwei Jieji (Shanghai) Trading Co., Ltd.;

[0027] S2. Design a pair of specific primers according to the codon-optimized chicken interferon alpha gene:

[0028] ChIFN-α-F: AATGCGGAATTCATGTGCAACCATCTGCGCCC

[0029] ChIFN-α-R: AATGCGAAGCTTCTAGGTGCGGGTGTTGCCGG

[0030] S3. Using the artificially synthesized chicken α-interferon gene a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an engineering bacterium for efficiently expressing recombinant ChIFN-alpha. The engineering bacterium is obtained by the following steps of S1, performing codon optimization synthesis on the ChIFN-alpha gene sequence published in Genebank according to the preference of the colibacillus codon; S2, designing a specific primer according to the optimized ChIFN-alpha gene; S3,performing PCR amplification on the ChIFN-alpha gene; cloning the PCR products onto prokaryotic expression vectors pET-41a through EcoRI and HindIII double enzyme digestion; S4, converting pET-41a-ChIFN-alpha recombinant plasmids with the correct sequencing into BL21(DE3) competent cells; S5, performing recombinant ChIFN-alphaprokaryotic expression and antiviral activity determination. The engineering bacterium disclosed by the invention can realize the efficient expression of the ChIFN-alpha; the antiviral activity of the obtained ChIFN-alpha can reach 1.71*10<7> UI / mg.

Description

technical field [0001] The invention relates to the technical field of gene recombination, in particular to an engineering bacterium for highly expressing recombinant chicken alpha interferon. Background technique [0002] In recent years, my country's poultry industry has developed rapidly and its scale has continued to expand. However, the prevalence of viral diseases such as avian influenza, Newcastle disease, and chicken infectious bronchitis has restricted the important factors for the development of the poultry industry. At present, methods such as vaccine immunization, chemical drugs and antibiotic treatment are still used in my country to prevent and control poultry diseases. However, due to the complexity of pathogenic serotypes and rapid mutation, the immune effect of vaccines is often poor. At the same time, the use of antibiotics and chemical drugs limits the scope of their use due to the problem of pathogenic drug resistance and drug residues. Therefore, there...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/70C12N15/21C07K14/56
CPCC07K14/56C12N15/70C12N2800/22
Inventor 焦培荣廖明吴斯宇黄鉴妮冯赛祥何婉婷
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com