Engineering bacterium for efficiently expressing recombinant ChIFN-alpha
An alpha interferon, high-efficiency expression technology, applied in the direction of interferon, cytokine/lymphokine/interferon, genetic engineering, etc., can solve the problem of high production cost and achieve the effect of high-efficiency expression and purification
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0024] The preferred embodiments of the present invention will be described below in conjunction with the accompanying drawings. It should be understood that the preferred embodiments described here are only used to illustrate and explain the present invention, and are not intended to limit the present invention.
[0025] An engineering bacterium for highly expressing recombinant chicken interferon alpha, which comprises the following steps:
[0026] S1. According to the codon preference of Escherichia coli, the chicken alpha interferon gene sequence (AB021154) published in Genebank was codon optimized, and the optimized gene was synthesized by Yingwei Jieji (Shanghai) Trading Co., Ltd.;
[0027] S2. Design a pair of specific primers according to the codon-optimized chicken interferon alpha gene:
[0028] ChIFN-α-F: AATGCGGAATTCATGTGCAACCATCTGCGCCC
[0029] ChIFN-α-R: AATGCGAAGCTTCTAGGTGCGGGTGTTGCCGG
[0030] S3. Using the artificially synthesized chicken α-interferon gene a...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com