Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Linker sequence and method for detecting ultra-low frequency mutation of target sequence

A linker sequence and target sequence technology, which is applied in the field of linker sequences with ultra-low frequency mutations, to achieve the effect of reducing the dosage and solving the heterogeneity of tumor cells

Inactive Publication Date: 2017-12-08
IGENETECH BIOTECH (BEIJING) CO LTD
View PDF7 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In order to solve the problem of ultra-low frequency mutation detection, the inventors proposed a linker sequence and method for detecting ultra-low frequency mutations of target sequences

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Linker sequence and method for detecting ultra-low frequency mutation of target sequence
  • Linker sequence and method for detecting ultra-low frequency mutation of target sequence
  • Linker sequence and method for detecting ultra-low frequency mutation of target sequence

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0053] In the embodiment of the present invention, a certain amount of tagged molecules are obtained by performing end-repair, A addition, adapter ligation, fragment enrichment and capture on the cfDNA standard HD780, which is then sequenced on the computer, combined with The later bioanalytical method corrects the positive and negative chains and analyzes the real mutation information.

[0054] Design and synthesis of linker sequences with molecular tags:

[0055] MID1:

[0056] AATGATACGGCGACCACCGAGATCTACACNNNNNNNNACACTCTTTCCCTACACGACGCTCTTCCGATCTAGATTGACT (SEQ ID NO. 1)

[0057] MID-1:

[0058] GTCAATCTAGATCGGAAGCAGCACACGTCTGAACTCCAGTCACAATGATGAATCTCGTATGCCGTCTTCTGCTTG (SEQ ID NO. 2)

[0059] MID2:

[0060] AATGATACGGCGACCACCGAGATCTACACNNNNNNNNACACTCTTTCCCTACACGACGCTCTTCCGATCTTACGTGACT (SEQ ID NO. 3)

[0061] MID2-2:

[0062] GTCAGCTAAGATCGGAAGACACACGTCTGAACTCCAGTCACAATGATGAATCTCGTATGCCGTCTTCTGCTTG (SEQ ID NO. 4)

[0063] MID3:

[0064] AATGATACGGCGACCACCGAGATCTACAC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a linker sequence and method for detecting the ultra-low frequency mutation of a target sequence. According to the method, a certain number of labeled molecules can be obtained by conducting terminal repair, A adding, linker connection, fragment enrichment, capture and the like on an interrupted genome or cfDNA, then on-machine sequencing is conducted, positive and negative chains are corrected by means of a later-period biological analysis method, and real mutation information is obtained through analysis.

Description

technical field [0001] The invention belongs to the field of high-throughput sequencing, and in particular relates to a linker sequence and a method for detecting ultra-low frequency mutation of a target sequence. Background technique [0002] Compared with the first-generation sequencing technology, the second-generation sequencing technology can detect tens of billions of sequence information at a time with less time and expense. It is possible to enter the era of precision medicine. At present, due to the advantages of high throughput, high efficiency, and moderate price of next-generation sequencing technology, it has been widely used in tumor detection, highlighting its advantages. However, during library construction, the high-fidelity enzyme has a replication error rate of 10 -6 , the error rate will also increase with the increase of the number of cycles. At the same time, during the sequencing process, the reading rate of the bases by the instrument is between 0.0...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6886C12Q1/6869C12Q2600/156C12Q2535/122C12Q2525/191
Inventor 余越美王瑞超邵谦之屈武斌蔡万世
Owner IGENETECH BIOTECH (BEIJING) CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com