Near-infrared fluorescent silver nucleinate nanometer cluster as well as preparation method and applications thereof
A technology of fluorescent nucleic acid silver and silver nanoclusters, applied in biochemical equipment and methods, fluorescence/phosphorescence, chemical instruments and methods, etc., can solve the problem of lack of tumor tissue targeting
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0017] Example 1 (the optimal preparation scheme of Trp-DNA-AgNCs@BSA): Using the DNA sequence as a template, add 6 μmol of DNA (the DNA sequence is "5'CCCACCCACCCTCCCAACAACAGAGGAG3 '") (the sequence was designed by ourselves, synthesized with a DNA synthesizer of Shanghai Bio-Shenggong Co., Ltd., purified by HPLC, and the sequence verified by mass spectrometry was 5'CCCACCCACCCTCCCAACAACAGAGGAG3'), 200μmolAgNO 3 (where DNA and Ag + The molar ratio of 1:33.33) and 150 μmol tryptophan (where tryptophan and Ag + The molar ratio is 1:1.33), mixed evenly and placed in a water bath, heated at 71°C for 2 minutes, then began to cool down, the cooling process took 2 hours, and then dropped to room temperature. Add NaBH to the reaction solution at room temperature 4 solution (wherein NaBH 4 with Ag + The molar ratio of the Trp-DNA-Ag + Reduction to Trp-DNA-Ag, the reaction solution was transferred to 4 ° C environment and kept in the dark for 2 days, and then added 3 μmol BSA (whe...
Embodiment 2
[0018] Example 2: Using the DNA sequence as a template, add 10 μmol of DNA (the DNA sequence is "5'CCCACCCACCCTCCCAACAACAGAGGAG3'") in 1 mL of sodium citrate buffer solution (pH 5.0, 10 mM) (the sequence is designed by ourselves, using Shanghai Biological Synthesized by DNA synthesizer of Sangon Company, purified by HPLC, and the sequence verified by mass spectrometry is 5'CCCACCCACCCTCCCAACAACAGAGGAG3'), 200μmol AgNO 3 (where DNA and Ag + The molar ratio of 1:20) and 200μmol tryptophan (where tryptophan and Ag + The molar ratio is 1:1), mixed evenly, placed in a water bath, heated at 71°C for 2 minutes, and then began to cool down. The cooling process took 2 hours, and then dropped to room temperature. Add NaBH to the reaction solution at room temperature 4 solution (wherein NaBH 4 with Ag + The molar ratio of the Trp-DNA-Ag + Reduction to Trp-DNA-Ag, the reaction solution was transferred to 4 ° C environment and kept in the dark for 2 days, and then added 4 μmol BSA (wh...
Embodiment 3
[0019] Example 3: Using the DNA sequence as a template, add 5 μmol of DNA (the DNA sequence is "5'CCCACCCACCCTCCCAACAACAGAGGAG3'") in 1 mL of sodium citrate buffer solution (pH 5.0, 10 mM) (the sequence is designed by ourselves, using Shanghai Biological Synthesized by DNA synthesizer of Sangon Company, purified by HPLC, and the sequence verified by mass spectrometry is 5'CCCACCCACCCTCCCAACAACAGAGGAG3'), 200μmol AgNO 3 (where DNA and Ag + The molar ratio of 1:40) and 100μmol tryptophan (where tryptophan and Ag + The molar ratio is 1:2), mixed evenly, placed in a water bath, heated at 71°C for 2 minutes, and then began to cool down. The cooling process took 2 hours, and then dropped to room temperature. Add NaBH to the reaction solution at room temperature 4 solution (wherein NaBH 4 with Ag + The molar ratio of the Trp-DNA-Ag +Reduction to Trp-DNA-Ag, the reaction solution was transferred to 4 ° C environment for 2 days in the dark, and then added 2.5 μmol BSA (wherein BSA...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com