Porcine NTF3 promoter region SNP as molecular marker for boar breeding traits and applications of porcine NTF3 promoter region SNP
A technique for molecular markers and boars, applied in the direction of DNA/RNA fragments, recombinant DNA technology, microbial determination/inspection, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1 Extraction of Boar Semen Genomic DNA Using Phenol Extraction
[0032]Inject the fresh semen of the boar collected on the spot (from China, Yaji Mountain Pig Artificial Insemination Center under Guangxi Yangxiang Pig Gene Technology Co., Ltd., the princess is a routinely reported American Duroc and Large White breed, the same below) Store in a 10ml centrifuge tube at -20°C. It was transported to the laboratory in a cold chain below 0°C, and then thawed in a water bath to extract the genomic DNA of boar semen. Specific steps are as follows:
[0033] (1) Take 1ml of semen, put it in a 2ml centrifuge tube, centrifuge at 5000rpm for 7min, discard the supernatant.
[0034] (2) Add 1000 ul of sperm washing liquid or normal saline to each centrifuge tube, mix by pipetting repeatedly, centrifuge at 12000 rpm for 7 min, and discard the supernatant.
[0035] (3) Repeat the above washing steps 1 to 2 times.
[0036] (4) Add 1000ul sperm lysate and 15-20ul proteinase K...
Embodiment 2
[0043] Embodiment 2: the acquisition of boar NTF3 5 ' flanking promoter region specific DNA fragment and the establishment of SNP detection method
[0044] The foreign blood-related pig "Duroc" and the Chinese local pig breed "Meishan pig" (from the experimental pig farm of Huazhong Agricultural University, which is a routinely reported breed) were selected as experimental materials, and the pig NTF3 gene (GeneBank accession number DQ917625.1 The mRNA sequence of ) is seed, compares in the genome of pig, designs following primer according to its 5' flanking sequence:
[0045] Forward primer F: 5'CTGGACCTCACAGGGGATG 3'
[0046] Reverse primer R: 5'CGATGGACACCTTGTTCACC 3'
[0047] Using the blood genome DNA of Duroc pigs (foreign blood-related pig breeds) and Meishan pigs (local pig breeds in China) as templates, PCR amplification was carried out with the above primer pairs, and the results are shown in figure 1 .
[0048] The PCR reaction system is shown in Table 1.
[00...
Embodiment 3
[0056] Example 3: Application of molecular markers cloned by the present invention in association analysis of boar reproductive traits
[0057] Statistics of Genotype Frequency and Allele Frequency
[0058] Genotype frequency: refers to the proportion of a specific genotype in a population to all genotypes in the population. The statistical method of genotype frequency is: genotype frequency = number of individuals of this genotype / total number of measured populations
[0059] Allele frequency: refers to the relative proportion of a gene in a population to the total genes at that locus. Statistical method of allele frequency: genotype frequency of homozygote of this gene + genotype frequency of heterozygote containing this gene / 2
[0060] Table 3 The genotype frequencies and allele frequencies of SNPs in the NTF3 promoter region in three breeds of pigs
[0061]
[0062]
[0063] In order to determine whether the SNP in the 5' flanking promoter region of the porcine NT...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com