Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kit for identifying circulating tumor cells using CD45 immunofluorescence combined with CEP17 probe and its application

A tumor cell and immunofluorescence technology, which is applied in the field of biomedical clinical detection, can solve the problems of finding target CTCs and restricting the application of FISH technology, and achieve the effect of reducing non-specific hybridization signals, reducing identification errors, and reducing counting errors

Active Publication Date: 2018-06-26
WUHAN HEALTHCHART BIOLOGICAL TECH
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

When fluorescence in situ hybridization technology is applied to the detection of CTCs chromosome polyploidy, gene breakage and gene fusion, due to the presence of a large number of blood cell backgrounds in the captured CTCs, it is extremely difficult to find target CTCs under a fluorescence microscope, which limits the use of FISH technology. Applications in CTCs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kit for identifying circulating tumor cells using CD45 immunofluorescence combined with CEP17 probe and its application
  • A kit for identifying circulating tumor cells using CD45 immunofluorescence combined with CEP17 probe and its application
  • A kit for identifying circulating tumor cells using CD45 immunofluorescence combined with CEP17 probe and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] A kit using CD45 immunofluorescence combined with CEP17 fluorescent in situ hybridization probe to identify circulating tumor cells, the composition of the kit is shown in Table 1 below:

[0042] Table 1 Kit composition

[0043]

Embodiment 2

[0045] Using the kit described in Example 1 to identify circulating tumor cells in breast cancer patients, using CD45 monoclonal antibody + chromosome 17 fluorescent in situ hybridization probe detection, chromosome 17 fluorescent in situ hybridization probe specific sequence (SEQ ID NO. 1) is: TGAACATTCCTTTGGATGGAGCAGGTTTGAGACACTCTTTTTGTACAATCTACAAGTGGATATTTGGACCTCTCTGAGGATTTCGTTGGAAACGGGATAACTGCACCTAACTAAACGGAAGCATTCTCAGAAACTTCTTGGTGATGTTTGCATTCAAATCCCAGAGT

[0046] Specifically include the following steps:

[0047] (1) Harvest cells: aspirate the captured circulating tumor cell samples (CTCs) into a sharp-bottomed centrifuge tube, centrifuge, 1000 rpm, 10 minutes, and remove the supernatant;

[0048] (2) Hypotonicity: add 6-8mL of 0.075mol / L KCL solution pre-warmed to 37℃, mix well with a pipette, then place in a 37℃ incubator for 20-30min;

[0049] (3) Pre-fixation: add 2 mL of fixative, pipette and mix, centrifuge at 1000 rpm for 10 minutes;

[0050] (4) Aspirate the supernatant, ...

Embodiment 3

[0064] Using the kit described in the embodiment of the present invention, CD45 immunofluorescence and CEP17 fluorescence in situ hybridization are used to detect circulating tumor cells in gastric cancer patients. The specific sequence of the fluorescent in situ hybridization probe of chromosome 17 (SEQ ID NO.1) is:

[0065] TGAACATTCCTTTGGATGGAGCAGGTTTGAGACACTCTTTTTGTACAATCTACAAGTGGATATTTGGACCTCTCTGAGGATTTCGTTGGAAACGGGATAACTGCACCTAACTAAACGGAAGCATTCTCAGAAACTTCTTGGTGATGTTTGCATTCAAATCCCAGAGT

[0066] Specifically include the following steps:

[0067] (1) Harvesting cells: extract 10ml of peripheral blood from the patient, and use a commercially available circulating tumor cell capture instrument or kit to capture circulating tumor cells (CTCs). The captured circulating tumor cells are sucked into a sharp-bottomed centrifuge tube, centrifuged at 1000 rpm / min, 10min, go to the supernatant;

[0068] (2) Hypotonicity: add 6-8mL of 0.075mol / L KCL solution pre-warmed to 37℃, mix well with a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biomedical clinical detection and relates to a kit for identification of circulating tumor cells through CD45 immunofluorescence-CEP17 fluorescence in-situ hybridization probe combined one-step method co-dyeing, and a use thereof. The kit comprises a fixing solution, 2*SSC, 0.3% NP-40 / 0.4*SSC, 0.075 M of a KCl solution, a CD45 monoclonal antibody-CEP17 probe mixed liquid, a DAPI redyeing agent, a perforating agent, a sealing liquid and a mounting medium. The kit uses combination of a CD45 immunofluorescent antibody and a CEP17 fluorescence in-situ hybridization probe to identify the captured circulating tumor cells, completes immunofluorescence and fluorescence in-situ hybridization detection by a one-step method, and solves the problem that the immunofluorescence detection and the fluorescence in-situ hybridization detection produce mutual interference in combined use and detection time is long. The one-step method-based hybridization incubation can be fast finished in 2h so that detection time is greatly reduced. The detection result is visual.

Description

Technical field [0001] The invention belongs to the field of biomedical clinical detection, and specifically relates to a kit for identifying circulating tumor cells using CD45 immunofluorescence combined with CEP17 fluorescent in situ hybridization probes and applications thereof. Background technique [0002] Circulating tumor cells (CTCs) refers to the general term for various types of tumor cells present in peripheral blood, which are released from solid tumor lesions (primary tumors, metastases) and released into the peripheral blood circulation due to spontaneous or diagnostic procedures. Cells, most of the CTCs undergo apoptosis or are phagocytosed after entering the peripheral blood, and a few can escape and anchor to develop into metastases. In recent years, the clinical manifestations of CTCs in tumor diagnosis, treatment and monitoring have gradually emerged. It is currently the most promising non-invasive diagnosis and real-time therapeutic effect monitoring method fo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): G01N33/577G01N33/569G01N33/533C12Q1/6886
CPCC12Q1/6841C12Q1/6888G01N33/533G01N33/56966G01N33/577C12Q2537/143C12Q2563/107
Inventor 叶伦李雪梅李倩程弘夏陈刚
Owner WUHAN HEALTHCHART BIOLOGICAL TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com