Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Visual cell repair efficiency reporting system based on artificial nuclease and establishing method of system

A technology for reporting systems and repairing efficiency, applied in biochemical equipment and methods, nucleic acid vectors, and the use of vectors to introduce foreign genetic material, etc.

Active Publication Date: 2017-05-31
NORTHWEST A & F UNIV
View PDF5 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] At present, there is no tool to integrate the same reporter gene into a carrier system using its different repair methods, and at the same time reflect the efficiency of each repair pathway at a specific site in eukaryotic cells. Most of the known reporter carrier systems can only independently and indirectly reflect eukaryotic The repair efficiency of a certain pathway in the cell

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Visual cell repair efficiency reporting system based on artificial nuclease and establishing method of system
  • Visual cell repair efficiency reporting system based on artificial nuclease and establishing method of system
  • Visual cell repair efficiency reporting system based on artificial nuclease and establishing method of system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0039] In order to make the technical solution of the present invention easy to understand, the following uses yeast-derived Rad52 protein (abbreviated as ScRad52) and CRISPR-Cas9 to edit human VEGFA gene, and detects the embodiment of ScRad52 improving the efficiency of HR after CRISPR-Cas9 targeting, for the present invention For further details.

[0040] 1. Target site selection

[0041] Based on the characteristics of the target sites of the CRISPR / Cas9 system, the target sites containing PAM (NGG / NGGNG) were searched in the genome. After screening on the CRISPR Dsign website (http: / / crispr.mit.edu / ), the following site was selected as the VEGFA target site (VEGFA target): CTCGGCCACCACAGGGAAGC (see SEQ.ID.NO.1, 5 from the left `end)

[0042] 2. Construction of CRISPR / Cas9 expression vector (pLL3.7-U6-VEGFA.sgRNA-CBh-SpCas9)

[0043] The CRISPR / Cas9 expression vector was transformed and constructed in our laboratory, that is, the sequence of the sgRNA capable of expressi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a visual cell repair efficiency reporting system based on artificial nuclease and an establishing method of the system. The visual cell repair efficiency reporting system comprises a bifluorescence reporting system expression vector constructed by a reporter gene I expression box into which a target gene target site is inserted, a complete reporter gene II expression box, and a truncated sequence of the reporter gene I. For the visual cell repair efficiency reporting system based on artificial nuclease, different repair mechanisms in the eukaryocytes are utilized and simulated so that the corresponding fluorescence expression boxes in the reporting system are repaired, a flow cytometry can be used for quantifying the expression of the two reporter genes of the bifluorescence reporting system expression vector, and the repair efficiency for HR, SSA and NHEJ of one certain genetic locus in the eukaryocyte is reported and detected at once in the vector level.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and relates to a set of methods for constructing a fast, efficient, and visual cell repair efficiency reporting system mediated by artificial nucleases, and specifically relates to the application of genetic engineering technology to simulate specific gene positions in eukaryotic cells at the level of reporting carriers Point damage, rough quantification for visualization of repair efficiency of different repair pathways and precise quantification by flow cytometry. Background technique [0002] Genome editing technology is a bioengineering technology for genetic modification and transformation of the genome. This technology is the "golden key" for people to understand and identify gene functions. The early transgenic technology mainly used random insertion to integrate foreign genes into the genome. The more common and efficient methods were the transposition effect mediated by the t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/79C12N15/65C12N15/66
CPCC12N15/65C12N15/66C12N15/79C12N2800/80C12N2810/10
Inventor 张智英邵斯旻徐坤韩芙蓉沈俊岑白义春
Owner NORTHWEST A & F UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com