Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A new rice gene wbph9(t) resistant to white-backed planthopper and its molecular marker method and application

A white-backed planthopper and molecular marker technology, applied in the field of plant molecular genetics, can solve problems such as unclear Wbph1, and achieve the effects of facilitating timely hybridization and breeding, improving the resistance level, and speeding up the breeding process.

Active Publication Date: 2019-08-23
GUANGXI ZHUANG AUTONOMOUS REGION ACAD OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

McCouch et al. (1991) detected RFLP markers RG146 and RG445 that co-segregated with Wbph1, but RG146 and RG445 were multicopy markers, and no other polymorphic markers were detected. It is still unclear which chromosome Wbph1 is on

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A new rice gene wbph9(t) resistant to white-backed planthopper and its molecular marker method and application
  • A new rice gene wbph9(t) resistant to white-backed planthopper and its molecular marker method and application
  • A new rice gene wbph9(t) resistant to white-backed planthopper and its molecular marker method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 : Obtaining molecular markers

[0027] (1) Gui 1025 / K41 F 2 Construction and phenotyping of family groups and RILs

[0028] 1. In the previous study, we used the hybridization and backcrossing of small-grain wild rice and cultivated rice IR24, combined with embryo rescue and molecular marker-assisted selection technology, to construct a set of small-grain wild rice introduction lines, which were identified and screened against white-backed planthopper. A rice line K41 with high resistance to white-backed planthopper and stable agronomic traits was obtained. In order to excavate the resistance gene in K41 and its closely linked molecular markers, the present invention takes the insect-susceptible variety Gui 1025 as the female parent and the insect-resistant strain K41 as the male parent to cross, and the obtained F 1 self-cross again, thus constructing F 2 separate groups, each F 2 The corresponding F was obtained from the individual plant through selfin...

Embodiment 2

[0045] Example 2 : Validation of molecular markers

[0046] (1) Materials and methods

[0047] Negative varieties: 30 copies. Insect-sensitive lines Gui 1025, Lemont and TN1 are all conventional rice materials preserved in the laboratory. Among the progeny of the hybrid combination Gui 1025 / K41, there are 27 susceptible families.

[0048] Positive varieties: 30 copies, and 29 copies of insect-resistant families in the descendants of the hybrid combination of the insect-resistant lines K41 and Gui 1025 / K41.

[0049] The upstream primer of the primer pair of GM21 is the sequence shown in Seq ID No.3, and the downstream primer of the primer pair is the sequence shown in SeqID No.4;

[0050] Seq ID No.3: AAAGAGATTTATAATCCAAATTTTGGCCA;

[0051] Seq ID No. 4: GCCAAAGTAATTTAGGCCTGA.

[0052] The DNA extraction method and the molecular marker analysis method are the same as in Example 1.

[0053] (2) Results

[0054]Using the above method, PCR amplification was performed on the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marking method for tight interlocking of new gene Wbph 9 (t) for resisting rice sogatella furcifera, and application thereof. Through genetic linkage analysis, a variety F41 of the high resistant sogatella furcifera and a variety laurel 1025 of high sensitive sogatella furcifera to obtain F2 which consists of 3 family groups and recombinant inbred line groups; a rice resistant sogatella furcifera gene Wbph 9 (t) on the #6 chromosome of the rice is accurately positioned; the gene is positioned in a 120kb zone between the molecular marker MG11 and MG 32; the selecting efficiency of 1 molecular market MG21 of the zone for the antigen single plant is about 98%; the molecular market tightly interlocked by Wbph 9 (t) is applied to detect if the insect resisting variety K41 and its derivative variety (series) contains the gene; thus new material for resisting sogatella furcifera can be selected. The invention is applied to the molecular marking of the rice sogatella furcifera resistance so as to assist the seed breeding and pyramiding breeding, so as to perform the gene type selection on the low generation of breeding material in seedling period; thus the breeding efficiency is improved, and the breeding progress is accelerated.

Description

technical field [0001] The invention belongs to the field of plant molecular genetics, and relates to a new rice white-backed planthopper-resistant gene Wbph9(t) and its molecular marker and application. Background technique [0002] White-backed planthopper is an important pest in rice production. It not only directly harms rice, but also transmits other diseases and viruses during the feeding process, which seriously threatens the safety of rice production in my country. Discovering and identifying new insect-resistant genes and breeding insect-resistant varieties are the most economical and effective means of control. There are only a few reports on the localization of rice white-backed planthopper resistance genes. McCouch et al. (1991) detected RFLP markers RG146 and RG445 that co-segregate with Wbph1, but RG146 and RG445 are multicopy markers, and no other polymorphic markers were detected, so it remains unclear on which chromosome Wbph1 is located. Liu Zhiyan et al....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C12N15/11C12Q1/6895A01H5/00A01H6/46
CPCC07K14/415C12N15/8286
Inventor 郭嗣斌李孝琼韦宇刘开强陈颖高国庆
Owner GUANGXI ZHUANG AUTONOMOUS REGION ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com