Recombinant vector for high-throughput yeast two-hybrid technology and method for large-scale screening of interacting proteins
A yeast two-hybrid and recombinant vector technology, applied in the field of yeast two-hybrid screening, can solve the problems of time-consuming, heavy workload, complicated operation, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0133] In order to better explain the present invention, the main content of the present invention is further clarified below in conjunction with specific examples, but the content of the present invention is not limited to the following examples.
[0134] 1. Construction of recombinant vector pGADT7-ATTP-phiC31 for yeast two-hybrid
[0135] 1) Synthesize the nucleotide sequence of solexa PE1-MCS-ATTP, see SEQ ID NO: 1, use the nucleotide sequence of solexa PE1-MCS-ATTP as a template to design a full-length primer pair with homology arms, and the primer pair is as follows :
[0136] Sol-Fo: gacgtaccagattacgctcatatgagaatgatacggcgaccaccg,
[0137] ATTP-Re: ctacgattcatctgcagctcgacagtgccccaactggggtaac
[0138] PCR amplification system:
[0139]
[0140] PCR instrument program: [95°C 20s→56°C 25s→72°C 30s]×30→72°C 5m→16°C 1s;
[0141] PCR amplification, OMEGA company E.Z.N.A. TM The Cycle-Pure Kit was recovered and purified to obtain the nucleotide sequence of solexa PE1-M...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com