Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of HoxC11 as biological marker for preparing lung adenocarcinoma pre-diagnostic reagent

A biomarker, hoxc11 technology, applied in biochemical equipment and methods, microbe measurement/test, disease diagnosis, etc., has achieved far-reaching clinical significance and important promotion and application prospects

Inactive Publication Date: 2017-01-04
CENT SOUTH UNIV
View PDF7 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are no reports about HoxC11 gene or protein as a new diagnostic marker and application of lung adenocarcinoma

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of HoxC11 as biological marker for preparing lung adenocarcinoma pre-diagnostic reagent
  • Application of HoxC11 as biological marker for preparing lung adenocarcinoma pre-diagnostic reagent
  • Application of HoxC11 as biological marker for preparing lung adenocarcinoma pre-diagnostic reagent

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1 Real-time fluorescent quantitative PCR method detection confirms that HoxC11 is up-regulated in lung adenocarcinoma

[0022] 1. Materials and methods:

[0023] 36 pairs of lung adenocarcinoma and adjacent normal control tissues were collected, total RNA was extracted, 1 μg RNA was reverse transcribed into cDNA, and real-time fluorescent quantitative PCR was performed. HoxC11 forward primer 5'-GAGGCTGAGGAGGAGAACAC-3' (SEQ ID NO.2) and HoxC11 reverse primer 5'-CTTGTCGGTCCGTCAGGTT-3' (SEQ ID NO.3).

[0024] Internal reference gene Beta-actin forward primer 5'-CACCATTGGCAATGAGCGGTTC-3' (SEQ ID NO.4) and internal reference gene Beta-actin reverse primer 5'-AGGTCTTTGCGGATGTCCACGT-3' (SEQ ID NO.5) used for control. The real-time fluorescent quantitative PCR reaction system is as follows:

[0025]

[0026] Real-time fluorescent quantitative PCR reaction steps

[0027]

[0028] After the reaction, the amplification curve and melting curve of real-time fluoresc...

Embodiment 2

[0031] Example 2 Analysis of data in the kaplan meier-plotter (www.kmplot.com) database found that the expression of HoxC11 in lung adenocarcinoma is related to the prognosis of patients.

[0032] result

[0033] The overall survival time of lung adenocarcinoma patients with high expression of HoxC11 is significantly lower than that of patients with low expression of HoxC11, and the prognosis is poor.

Embodiment 3

[0034] Example 3 Constructing an overexpression HoxC11 vector to overexpress HoxC11

[0035] 1. Material method

[0036] 1.1 Reagents and kits

[0037] HOXC11 bacteria solution ThermoCat.MHS6278-202755988

[0038] Restriction enzymes Age I, NheI, T4 DNA ligase, etc. were purchased from TakaRa;

[0039] PLJM1-EGFP(8038bp) addgene

[0040] EcoliDH5α Competent Cells Takara

[0041] TRIZOL TM Reagent (Invitrogen);

[0042] Plasmid Extraction Kit (#D6943-01, OMEGA);

[0043] Gel recovery kit (#M5212, OMEGA);

[0044] Reverse transcription kit (#A3500, Promega);

[0045] The antibiotic puromycin (Ameresc).

[0046] 1.2 Design of HoxC11 (CDS) primers

[0047] Find the HoxC11 (CDS) sequence through the UCSC database, and then design primers through the enzyme-cut protection base database

[0048] F:AGTC GCTAGC ATGTTTAACTCGGTCAACCTG (SEQ ID NO. 6) NheI

[0049] R: CGGGT ACCGGTAGCAGCAGAGGATTTCCCGAGA (SEQ ID NO. 7) AgeI

[0050] Primer description: Contains enzyme-cle...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an HoxC11 gene or HoxC11 gene which can be used for preparing a lung adenocarcinoma pre-diagnostic reagent and a kit and preparing lung adenocarcinoma pre-diagnostic prognosis evaluation reagents or treatment drugs. Reverse transcription is performed after RNA is extracted from a normal lung tissue sample of lung adenocarcinoma, expression of HoxC11 is detected through a real-time fluorescence quantification method, and a result shows that HoxC11 can be highly expressed in lung adenocarcinoma tissue. It is promoted that HoxC11 can be used as a lung adenocarcinoma pre-diagnostic molecular marker. The powerful molecular biology tool is provided for lung adenocarcinoma auxiliary diagnosis and prognosis prediction, and the profound clinic significance and significant application and popularization prospects are achieved.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to the application of HoxC11 gene or protein in the preparation of lung cancer diagnosis, prognosis evaluation and treatment, in particular to the application of HoxC11 as a biomarker in the preparation of a prediagnostic reagent for lung adenocarcinoma. Background technique [0002] Lung cancer is currently the malignant tumor with the highest morbidity and mortality in the world. There are 1.6 million new cases of lung cancer each year, accounting for 13% of all malignant tumors. Lung cancer is divided into two categories, non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC), the most common of which is non-small cell lung cancer, accounting for about 80%. Non-small cell mainly includes lung adenocarcinoma, lung squamous cell carcinoma and large cell lung cancer. In recent years, the proportion of lung adenocarcinoma is very high, accounting for about 50% of lung cancer...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68G01N33/574
CPCC12Q1/6886C12Q1/686C12Q2600/118C12Q2600/158G01N33/57423G01N2800/52C12Q2561/113C12Q2563/107C12Q2545/114C12Q2531/113
Inventor 陶永光刘晓丽刘双
Owner CENT SOUTH UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com