Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Signal peptidase inhibitor F25P preproinsulin and application thereof to preparation of tumor treatment medicine

A signal peptidase, tumor drug technology, applied in anti-tumor drugs, drug combinations, specific peptides, etc., to achieve the effect of inhibiting the synthesis of exocrine proteins, inhibiting metastasis and progression, and having great clinical significance

Inactive Publication Date: 2016-10-12
GENERAL HOSPITAL OF TIANJIN MEDICAL UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The present invention aims to solve the problem that there is no inhibitor for tumor extracellular secreted protein signal peptidase in the existing drugs for treating tumors, and proposes a signal peptidase inhibitor F25P preproinsulin and its application in the preparation of drugs for treating tumors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Signal peptidase inhibitor F25P preproinsulin and application thereof to preparation of tumor treatment medicine
  • Signal peptidase inhibitor F25P preproinsulin and application thereof to preparation of tumor treatment medicine
  • Signal peptidase inhibitor F25P preproinsulin and application thereof to preparation of tumor treatment medicine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0023] The present invention will be further described below in conjunction with the accompanying drawings and embodiments.

[0024] 1. Nucleotide sequence

[0025] 1.1 Nucleotide sequence of F25P preproinsulin (mutant insulin)

[0026] TCGTTTAGTGAACCGTCAGATCGCACCGGCGCCACCATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCCCTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACGAATTCATGGACTACAAGGATGACGATGACAAGGATTACAAAGACGACGATGATAAGGACTATAAGGATGATGACGACAAATGAACGCGTGGCCTCCGCGCCGGGTTTTGGCGCCTCCCGCGGGCGCCCCCCTCCTCACGGCGAGCGCTGCCACGTCAGACGAAGGGCGCAGCGAGCGTCCTGATCCTTCCGCCCGGACGCTCAGGACAGCGGCCCGCTGCTCATAAGACTCGGCCTTAGAACCCCAGTATCAGCAGAAGGACATTTTAGGACGGGACTTGGGTGACTCTAGGGCACTGGTTTTCTTTCCAGAGAGCGGAACAGGCGAGGAAAAGTAGTCCCTTCTCGGCGATTCTGCGGAGGGATCTCCGTGGGGCGGTGAACGCCGA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a signal peptidase inhibitor F25P preproinsulin and application thereof to preparation of tumor treatment medicine and belongs to the field of peptide-containing medicine preparations. The signal peptidase inhibitor F25P preproinsulin is a mutant of a proinsulin precursor, mutation sites are basic groups at the 73rd and 74th positions of the nucleotide sequence of the proinsulin precursor. The nucleotide sequence of the F25P preproinsulin is as shown in the Sequence 1. The signal peptidase inhibitor F25P preproinsulin can well and specifically inhibit signal peptidase activity of tumor cells, effectively inhibit synthesis of exocrine protein, inhibit tumor metastasis and progression and have a tumor prevention function. The invention provides a brand new tumor treatment medicine which has great clinical significance.

Description

technical field [0001] The invention belongs to the field of pharmaceutical preparations containing peptides, in particular to a signal peptidase inhibitor F25Ppreproinsulin and its application in the preparation of drugs for treating tumors. Background technique [0002] The exocrine phenomenon of cells plays an important role in physiological and pathological processes such as immune surveillance, inflammatory response and cancer development, especially in the communication between tumor cells, the growth support of surrounding tumor cells, the change of tumor extracellular matrix, the target Gene recoding in cells and tumor development, invasion and metastasis are particularly important. Current studies have found that there are specific differences in the exocrine function of tumor cells in different tumors and in different regions of the same tumor. Therefore, the exploration of tumor cell exocrine function is of great significance in the study of tumor pathogenesis, e...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/62A61K38/28A61P35/00
CPCA61K38/00C07K14/62
Inventor 康春生魏建伟刘铭崔景秋陈鹭跃杨超
Owner GENERAL HOSPITAL OF TIANJIN MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com