Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Primer, probe and kit for evaluating skin moisturizing conditions

A kit and water-locking technology, applied in the field of beauty, can solve problems such as difficult to achieve personalized maintenance or treatment, and achieve the effect of clear molecular mechanism, strong specificity and high sensitivity

Inactive Publication Date: 2016-07-27
FUJIAN AIWO HEALTH BIOTECH CO LTD
View PDF5 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The above patents / patent applications all use foreign substances to regulate the expression of genes in the body, but there are different SNP sites in the genes of each individual. This method is difficult to achieve personalized maintenance or treatment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, probe and kit for evaluating skin moisturizing conditions
  • Primer, probe and kit for evaluating skin moisturizing conditions
  • Primer, probe and kit for evaluating skin moisturizing conditions

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] Example 1: Primer and probe design

[0066] 1. Design and synthesize the following primers and probes. Synthesis unit: Applied Biosystems, USA Applied Biotechnology Co., Ltd.

[0067] HAS1 (rs11084109) primer and fluorescent probe sequence:

[0068] Forward primer CCAGCCCCAATCGTCATCCAT SEQ ID NO: 1;

[0069] reverse primer ATCCTGCATCAGCGGTCCTC SEQ ID NO: 2;

[0070] Fluorescent Probe FAM-CCATATC C TTTTTCCAACC – MGB SEQ ID NO: 3;

[0071] Fluorescent probe VIC-CCATATC T TTTTTCAACC – MGB SEQ ID NO: 4;

[0072] HAS1 (rs11084111) primer and fluorescent probe sequence:

[0073] Forward primer CCGCTCCACATTGAAGGCTA SEQ ID NO: 5;

[0074] reverse primer ATGCCTTCCTCTCAAGCATC SEQ ID NO: 6;

[0075] Fluorescent Probe FAM-ATCCGCAC A TCCCCACCAAC-MGB SEQ ID NO: 7;

[0076] Fluorescent probe VIC-ATCCGCAC G TCCCCACCAAC–MGB SEQ ID NO:8;

[0077] 2. SNP site detection

[0078] 1), sample collection. The test sample in this example uses human saliva, 30 minutes before the sa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer, probe and kit for evaluating skin moisturizing conditions. The sequences of the primer and the probe are SEQ ID NO:1-4 and SEQ ID NO:5-8, wherein 5' end and 3' end of SEQ ID NO: 3-4 and 7-8 are connected with different fluorescence labelings. The invention also discloses a method for assisting customers to select correct beautifying methods by using gene detection, enabling the customers to know both the internal and external causes of dry skin, providing personalized beauty and health solutions for the customers, and maximizing the effect of moisturizing beauty products.

Description

technical field [0001] The invention relates to the field of cosmetology, in particular to a primer, a probe and a kit for evaluating skin moisture retention. Background technique [0002] SNP (single nucleotide polymorphism) refers to the variation of a single nucleotide on the genome, including transitions, transversions, deletions, and insertions. It is the most common genetic marker, and its carrying frequency in the population is greater than 1%. , and are widely used in the fields of human disease diagnosis, individualized drug use, and basic biological research. With the in-depth study of different SNP sites, through the combined detection of multiple SNP sites and subsequent data analysis, personalized health solutions can be formulated for the genetic information of different groups of people. [0003] The appearance of human skin is affected by internal and external factors. External factors include ultraviolet rays, environmental pollution, improper use of beauty...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6883C12Q2600/156
Inventor 纪志梁王毛阳刘晓瑜杨志云
Owner FUJIAN AIWO HEALTH BIOTECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com