Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of ischemic stroke screening kit and its application

A technique for ischemic stroke and cerebral apoplexy, which is applied in the direction of biochemical equipment and methods, microbial measurement/testing, etc., and can solve the problems of limited wide application of cerebral hemorrhage in the treatment time window

Active Publication Date: 2019-01-29
NANJING MEDICAL UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, only tissue plasminogen activator (tPA) is approved by the US FDA for the treatment of stroke. Due to its strict treatment time window and complications such as cerebral hemorrhage, its wide clinical application is greatly limited. Drug development still has a long way to go

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of ischemic stroke screening kit and its application
  • A kind of ischemic stroke screening kit and its application
  • A kind of ischemic stroke screening kit and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1: To predict the target site of miRNA-98 acting on PAFR, the interaction between miRNA-98 and the promoter region of PAFR was detected by using a dual luciferase reporter gene.

[0039] (1) pairing indication Figure 12 shown;

[0040] (2) Design primers

[0041] PTAFR-miR98-5p F (SEQ ID NO: 1): XhoI: cacaactcgag TCATTTCCTGTGTACCGGGC;

[0042] PTAFR-miR98-5pR (SEQ ID NO: 2): BamHI: aaggatcc TAAGGGACCTGCAAAAGCCTG;

[0043] PTAFR-miR98-5pM R (SEQ ID NO: 3): CTCCATCCTTTAACCTCATAGGTAATGACCCTAACTCCATCGAAATTCAGTGCCTGGT;

[0044] PTAFR-miR98-5pM F (SEQ ID NO: 4): GATGGAGTTAGGGTCATTACCTATGAGGTTAAAGGATGGAGATGGGATTGTTATACGCC;

[0045] The size of the PCR product is 442bp.

[0046] (3) Construction of pLUC-PTAFR reporter gene vector:

[0047] The contained 3'UTR sequence is as follows (SEQ ID NO:5):

[0048]

[0049] (4) Construction of pLUC-PTAFRMut reporter gene vector:

[0050] The contained 3'UTR sequence is as follows (SEQ ID NO:6):

[0051]

[005...

Embodiment 2

[0060] Example 2: Detection of the expression of miRNA-98 in the serum of stroke patients, the serum of ischemic stroke model animals, and the penumbra

[0061] Detection method: Real-time PCR

[0062] Test result: if figure 2 A ~ C shown.

[0063] Result analysis: Compared with the healthy control group, the miRNA-98 in the serum of stroke patients was significantly lower; compared with the animals of the sham operation group, the expression of miRNA-98 in the serum and penumbra of the ischemic stroke animals was significantly lower.

Embodiment 4

[0064] Example 4: Detection of platelet activating factor level in serum of stroke patients.

[0065] Detection method: ELISA assay kit was used to detect the content of PAF in serum of patients.

[0066] Result determination: if image 3 shown.

[0067] Analysis of the results: Compared with the healthy control group, the serum PAF of stroke patients increased 3.4 times, up to 505.7±93.6pg / ml.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of miRNA-98 to preparation of an ischemic stroke screening kit and discloses that miRNA-98 affects a PAFR (platelet activating factor receptor) and the signal transduction process related to downstream inflammations so as to play roles in stokes through targeted negative regulation of expression of the PAFR. A new action mechanism is provided for the application of the miRNA-98 to diagnosis of ischemic strokes.

Description

technical field [0001] The invention belongs to the technical field of gene detection, and in particular relates to an ischemic stroke screening kit and its application. Background technique [0002] RNA is one of the most important material bases in organisms, and together with DNA and proteins, it constitutes the framework of life. But for a long time, RNA was thought to be just a "transition" between DNA and protein, from which it obtained its sequence and then converted genetic information into protein. However, a series of studies have shown that these small RNAs actually manipulate many cellular functions, and they can turn off or regulate gene expression by reacting against DNA through the binding of complementary sequences. A recently discovered non-protein-coding RNA family, microRNA (miRNA, microRNA), can regulate gene expression by binding to specific mRNA or regulating the protein translation process of specific mRNA. At present, there are more than one thousan...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6883
CPCC12Q1/6883C12Q2600/178
Inventor 孙秀兰吴晋季娟赵展董银凤乔晨
Owner NANJING MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com