A Recombinant Escherichia coli and Its Application in Fermentative Production of 2[4fe4s]ferredoxin
A technology for recombinant Escherichia coli, protein, applied in fermentation, microorganism-based methods, bacteria and other directions, can solve the problems of high protein price, low activity, low expression, etc., and achieve good application prospects, increased yield, and high expression. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1: Construction of recombinant Escherichia coli highly expressing 2[4Fe4S]-type ferredoxin in C.pasteurianum DSM 525
[0035] Take C.pasteurianum DSM 525 cells, and extract genomic DNA from C.pasteurianum DSM 525 cells according to the method recommended by the bacterial genomic DNA extraction kit. According to the known 2[4Fe4S]-type ferredoxin gene sequence in the genome of Clostridium pasteurianum (C.pasteurianum) DSM 525 as shown in SEQ ID NO.1, the primers were designed as follows:
[0036]F Primer: 5'GACGACGACAAGATGGCATATAAAATCGCTGATTCATGTG 3'
[0037] R primer: 5'GAGGAGAAGCCCGGTTATTCTTGTACTGGTGCTCCAACTGGA 3'
[0038] Using the extracted C. pasteurianum DSM 525 genomic DNA as a template, KOD hot-start DNA polymerase was used for PCR amplification to obtain 2[4Fe4S]-type ferredoxin gene. The PCR reaction system is as follows:
[0039]
[0040] The PCR reaction conditions are:
[0041] 95℃5min
[0042] 95°C 30s, 55°C 30s, 72°C 30s 30 cycles
[0043]...
Embodiment 2
[0048] Embodiment 2: the application of recombinant escherichia coli highly expressed 2 [4Fe4S] ferredoxin
[0049] (1) Inoculate the recombinant Escherichia coli strain constructed in Example 1 into the TB medium containing antibiotics and iron-sulfur sources with an inoculum size of 1% by volume, and cultivate it at 37°C and 180rpm for 2 to 3 hours to OD 620nm is 0.6, the bacterial liquid is obtained;
[0050] Among them, the formula and final concentration of components of the above-mentioned TB medium are: Tryptone 12g / L, Yeast extract24g / L, Glycerol 4ml / L, KH 2 PO 4 2.3g / L, K 2 HPO 4 12.5g / L;
[0051] The above-mentioned antibiotics are chloramphenicol with a final concentration of 25 μg / ml, tetracycline with a final concentration of 10 μg / ml, and carbenicillin with a final concentration of 25 μg / ml;
[0052] The formula and final concentration of the above-mentioned iron and sulfur sources are: ferric ammonium citrate 0.2-0.3g / L, L-cysteine 0.1-0.2g / L, ferric ci...
Embodiment 3
[0056] Example 3: Separation, purification and activity determination of 2[4Fe4S]ferredoxin.
[0057] The purification of protein was carried out in an anaerobic operation box, and all solutions used were degassed and anaerobic treated after boiling.
[0058] Prepare the buffer required for purification: buffer A: Tris-HCl 100mM, NaCl 150mM, DTT 2mM, pH7.5; buffer B: sodium phosphate Tris-HCl 100mM, NaCl 150mM, DTT 2mM, desthiobiotin 2.5mM, pH7. 5; Buffer W: sodium phosphate 50 mM, pH 7.0.
[0059] Acquisition of crude enzyme solution: resuspend the frozen cells prepared in Example 2 with buffer A containing 10% glycerol, and use an ultrasonic disruptor to disrupt the cells. The cell disruption procedure is: working time 6 seconds, intermittent time 6 seconds , power 39%, total crushing time is 50 minutes. After the crushing is completed, centrifuge at 12,000 rpm for 30 minutes, take the supernatant and filter it with a 0.22um pore size filter membrane, and place it on ice a...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com