Application method of EB virus encoded microRNA BART10
An application method and coding technology, applied in the field of tumor molecular biology, can solve problems such as inability to speculate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Example 1, real-time fluorescent quantitative PCR method detection confirmed that EBV-miR-BART10 was up-regulated in nasopharyngeal carcinoma
[0038] 1. Materials and methods:
[0039] Collect 5 cases of normal nasopharyngeal epithelial tissues and 18 cases of nasopharyngeal carcinoma tissues, extract total RNA with Trizol (product of Invitrogen Company), reverse transcribe 2 μg RNA into cDNA with miScript reverse transcription kit (product of Qiagen Company), and use QuantiTectSYBRGreenPCR kit (Qiagen company product) Real-time fluorescent quantitative PCR was used to detect the expression of EBV-miR-BART10 and internal reference gene RNU6. The public primers (UniversalPrimer) of microRNA and the specific primers of EBV-miR-BART10 and RNU6 were designed and synthesized by Qiagen Company.
[0040] Real-time fluorescence quantitative PCR reaction system
[0041]
[0042] Real-time fluorescent quantitative PCR reaction steps
[0043]
[0044]
[0045] After t...
Embodiment 2
[0048] Example 2, in situ hybridization detection found that the expression of EBV-miR-BART10 in nasopharyngeal carcinoma is related to the prognosis of patients
[0049] 1. Material method
[0050] 1.1 Design and synthesis of hybridization probes
[0051] In order to detect the expression of EBV-miR-BART10 by in situ hybridization, we designed oligonucleotide probes for detecting EBV-miR-BART10 expression by in situ hybridization and positive control in situ hybridization oligonucleotide probes.
[0052] EBV-miR-BART10 probe: ACAGCCAACUCCAUGGUUAUGUA
[0053] Positive control probe (to detect the housekeeping gene GAPDH):
[0054] GAPDH probe: CAGUAGAGGCAGGGAUGAUGUUCU
[0055] The gene-specific oligonucleotide probe sequences designed above were synthesized by chemical synthesis method, and uracil in the probe sequences was labeled with biotin (bio-U) during the synthesis process.
[0056] 1.2 Oligonucleotide probe labeling kit and in situ hybridization detection reagent ...
Embodiment 3
[0117] Example 3, overexpression of EBV-miR-BART10 in nasopharyngeal carcinoma cells promotes the invasion and metastasis of nasopharyngeal carcinoma
[0118] 1. Material method
[0119] 1.1 Cell culture and transfection
[0120]The EBV-negative nasopharyngeal carcinoma cell line HNE2 was purchased from the Cell Center of Central South University. The RPMI1640 medium and fetal bovine serum used for cell culture, and the trypsin used for digesting cells were all products of Gibco, USA.
[0121] EBV-miR-BART10 is synthesized by Invitrogen Company through chemical synthesis, and the sequence is:
[0122] UACAUAACCAUGGAGUUGGCUGU
[0123] The well-growing nasopharyngeal carcinoma cell line HNE2 was divided into 2×10 5 Cells / well were seeded in a 6-well plate, and the 6-well plate was placed at 37°C, 5% CO 2 In the incubator, the transfection of EBV-miR-BART10 can be started when the cells to be cultured grow to a density of 50-70%; the transfection process is as follows:
[01...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com