Construction method of enramycin high-yielding strain and related gene
A technology of enramycin and gene, applied in the field of molecular breeding of industrial microorganisms, to achieve the effect of overcoming the screening work
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0036] The embodiments of the present invention are described in detail below; it should be noted that the embodiments are descriptive, not restrictive, and cannot limit the protection scope of the present invention.
[0037] The applicant made a comparison and designed three sets of mutation primers to produce three mutant sequences at the same time. However, through testing the yield and resistance results, the results of the other two were poor, so the two outer M2 and M3 are no longer specifically provided. The specific sequence and primer sequence.
[0038] All primers involved and used in the M1 sequence are as follows:
[0039] rpsLF1:gtgcctacgatccagcagct
[0040] rpsLR1: acttctccttcttggcgc
[0041] rpsLF2: gccgagttcggcttcttcg
[0042] rpsLR2: acaacctgcaggagcactcc
[0043] S12F1: ccgaattctgaacggcaaggcggtcgc
[0044] S12R1: gcaagcttgcaggtcaagtgaagtggta
[0045] MrpsLR1:accaccccgaacaagccgaa
[0046] MrpsLF1:ttcggcttgttcggggtggt
[0047] The invention belongs to th...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com