A method for constructing a pyrosequencing library
A technology of pyrosequencing and method construction, which is applied in the fields of chemical library, biochemical equipment and method, and microbial measurement/inspection. It can solve the problems of incomplete information, large loss of reagents and samples, and low efficiency of library construction. Complete information, improve the success rate, and improve the efficiency of database construction
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0033] (1) Sample DNA extraction and quantification using Qubit Fluorometer, the concentration is 81μg / μl;
[0034] (2) DNA fragmentation, purification and fragment selection: use Covaris ultrasonic interrupter to fragment DNA, purify and recover the target fragment, quantify and select the fragment, and use Qiagen PCR purification kit for purification and use Qubit fluorometer to quantify , The concentration is 64μg / μl;
[0035] (3) Fill in the end and add an A tail: Fill in the DNA end and add an A tail at the 3'end;
[0036] (4) Y joint connection, joint is joint b:
[0037] Forward connector: 5'GTCGTACAGCTAGTCCTGAGGATGCAGTTCACTAGT3',
[0038] Reverse connector: 3'CCTAGCTGCATACGTCACACGAGTCAGTGATCTp 5'.
[0039] The labels are TCACTAGT and AGTGATCT, and the forward and reverse joints are annealed to form a partially complementary pair of Y-joints;
[0040] (5) 96 labels are designed on the joint, which can process 96 samples at a time;
[0041] (6) Use the AMPure magnetic bead purificat...
Embodiment 2
[0045] (1) Sample DNA extraction and quantification using Qubit Fluorometer, the concentration is 96μg / μl;
[0046] (2) DNA fragmentation, purification and fragment selection: use Covaris ultrasonic interrupter to fragment DNA, purify and recover the target fragment, quantify and select the fragment, and use Qiagen PCR purification kit for purification and use Qubit Fluorometer for quantification , The concentration is 71μg / μl;
[0047] (3) Fill in the end and add an A tail: Fill in the DNA end and add an A tail at the 3'end;
[0048] (4) Y connector connection, the connector is connector a:
[0049] Forward connector: 5'GCAAGTCTCGATTGGAGCTCTGCTCCAGTGCATCACT 3',
[0050] Reverse connector: 3'GTACATGCACGACTCAGTCCTGATCCGTAGTGAp 5',
[0051] The tags are GCATCACT and CGTAGTGA, and the forward and reverse connectors are annealed to form a partially complementary pair of Y-shaped connectors;
[0052] (5) 96 labels are designed on the joint, which can process 96 samples at a time;
[0053] (6) ...
Embodiment 3
[0057] (1) Sample DNA extraction and quantification using Qubit Fluorometer, the concentration is 51μg / μl;
[0058] (2) DNA fragmentation, purification and fragment selection: use Covaris ultrasonic interrupter to fragment DNA, purify and recover the target fragment, quantify and select the fragment, and use Qiagen PCR purification kit for purification and use Qubit fluorometer to quantify , The concentration is 50μg / μl;
[0059] (3) Fill in the end and add an A tail: Fill in the DNA end and add an A tail to the 3'end;
[0060] (4) Y joint connection, joint is joint b:
[0061] Forward connector: 5'GTCGTACAGCTAGTCCTGAGGATGCAGTTCACTAGT3',
[0062] Reverse connector: 3'CCTAGCTGCATACGTCACACGAGTCAGTGATCTp 5'.
[0063] The labels are TCACTAGT and AGTGATCT, and the forward and reverse joints are annealed to form a partially complementary pair of Y-joints;
[0064] (5) 96 labels are designed on the joint, which can process 96 samples at a time;
[0065] (6) Use the AMPure magnetic bead purificat...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com