Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Applications of human RRS1 gene and inhibitor

A technology of genes and nucleic acid molecules, which is applied in the field of human RRS1 gene application and inhibitors, can solve problems such as no relevant research reports

Active Publication Date: 2015-07-15
SHANGHAI JI KAI GENE TECH CO LTD
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are no relevant research reports on RRS1 in tumor-related fields, especially for colon cancer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Applications of human RRS1 gene and inhibitor
  • Applications of human RRS1 gene and inhibitor
  • Applications of human RRS1 gene and inhibitor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Example 1: Preparation of lentivirus that inhibits human RRS1 gene

[0056] 1. Screening for effective siRNA targets against human RRS1 gene

[0057] Retrieve RRS1 (NM_015169) gene information from Genbank; select effective siRNA targets for RRS1 gene. Table 1 lists 5 effective siRNA target sequences for the RRS1 gene, as shown in SEQ ID NO: 1-5.

[0058] Table 1 siRNA target sequence targeting human RRS1 gene

[0059] SEQ ID NO

TargetSeq

1

CCGCTGCCTTCATTGAGTTTA

2

CCGTCTGTAAACCAAGGACTA

3

CAGAGAAGTTGCAACGCATCA

4

CGTCTGTAAACCAAGGACTAT

5

CCGGGAATGAGTTCTATTCTT

[0060] 2. Preparation of lentiviral vector

[0061] Aim at the siRNA target (taking SEQ ID NO: 1 as an example) to synthesize a double-stranded DNA Oligo sequence (Table 2) with Age I and EcoR I restriction endonucleases at both ends; use Age I and EcoR I restriction enzyme Act on the pGCSIL-GFP carrier (purchased from Shanghai Jikai Gene...

Embodiment 2

[0084] Example 2: Real-time fluorescent quantitative RT-PCR method to detect the silencing efficiency of RRS1 gene

[0085] Colon cancer RKO cells in the logarithmic growth phase were digested with trypsin to make a cell suspension (the number of cells was about 5×10 4 / ml) were inoculated in a 6-well plate and cultured until the cell confluency reached about 30%. According to the multiplicity of infection (MOI, RKO: 10) value, an appropriate amount of the virus prepared in Example 1 was added, the culture medium was replaced after 24 hours of cultivation, and the cells were collected after the infection time reached 4 days. Total RNA was extracted according to the instruction manual of Invitrogen's Trizol. According to the M-MLV operation manual of Promega Company, the RNA was reverse-transcribed to obtain cDNA (reverse transcription reaction system is shown in Table 7, 42 ° C for 1 h) and then in a 70 ° C water bath for 10 min to inactivate the reverse transcriptase.

[00...

Embodiment 3

[0093] Example 3: Detection of proliferation ability of tumor cells infected with RRS1-siRNA lentivirus

[0094] Colon cancer RKO cells in the logarithmic growth phase were digested with trypsin to make a cell suspension (the number of cells was about 5×10 4 / ml) were inoculated in a 6-well plate and cultured until the cell confluency reached about 30%. According to the multiplicity of infection (MOI, RKO: 10), an appropriate amount of virus was added, and the culture medium was replaced after 24 hours of culture. After the infection time reached 4 days, the cells of each experimental group in the logarithmic growth phase were collected. The complete medium was resuspended into a cell suspension (2×10 4 / ml), inoculate a 96-well plate at a cell density of about 2000 / well. 5 replicate wells in each group, 100 μl per well. After laying the board, place at 37°C, 5% CO 2 Incubator cultivation. From the second day after plating, the Cellomics ArrayScan VTI high-content screeni...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biology, and discloses the applications of human RRS1 gene in screening tumor treatment drugs and preparing tumor diagnosis / treatment drugs and an inhibitor. The human RRS1 gene is taken as the target, a proper target gene sequence is selected, and then an inhibitor is designed through a RNA interference mode, the inhibitor can efficiently inhibit the expression of RRS1 gene, and inhibit the nucleic acid molecules, recombinant carriers, slow viruses, which can promote the proliferation of human tumor cells especially colon cancer cells; the invention further provides applications of human RRS1 gene in screening tumor treatment drugs and preparing tumor diagnosis / treatment drugs, and the means for treating tumors are increased.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the application and inhibitor of human RRS1 gene. Background technique [0002] RNA interference (RNA interference, RNAi) is the use of short double-stranded RNA (dsRNA) composed of nucleotides for post-transcriptional gene silencing. It can efficiently and specifically block the expression of a specific gene in the body, leading to its degradation, thereby causing the silencing of a specific gene in the organism, and causing the cells to show the absence of a certain gene phenotype. It is a commonly used research gene emerging in recent years. Functional, laboratory techniques for finding cures for disease. Studies have shown that double-stranded RNA with a length of 21-23nt can specifically induce RNAi at the transcriptional and post-transcriptional levels. Although cancer patients have undergone chemotherapy, radiotherapy and comprehensive treatment, their five-year survival rat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/113C12N15/867A61K48/00A61K31/713A61P35/00
Inventor 朱向莹张晓慧沈克谢胜华徐述曹跃琼
Owner SHANGHAI JI KAI GENE TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com