Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Small molecule inhibitor and application thereof

A technology of small molecule inhibitors and inhibitors, applied in medical preparations containing active ingredients, organic active ingredients, anti-infective drugs, etc., can solve problems such as large toxic side effects, high concentration of action, and weak binding ability

Active Publication Date: 2015-07-01
CHINA THREE GORGES UNIV
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, its binding ability to ODC is weak, and its concentration is very high, and because it is a suicide inhibitor that forms a covalent bond with ODC, its toxic and side effects are very large

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Small molecule inhibitor and application thereof
  • Small molecule inhibitor and application thereof
  • Small molecule inhibitor and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] The small molecule inhibitor involved is: 4-(2,3-Dihydro-1H-perimidin-2-yl)-benzonitrole, the structural formula is as follows:

[0042]

[0043] The activity detection method is as follows:

[0044] 1. Construction of human ODC prokaryotic expression plasmid

[0045] The gene sequence of human ODC was inserted into the pET28a plasmid through BamH I and Xho I restriction sites to construct the pET28a-hODC plasmid, which was verified by DNA sequencing.

[0046] Gene sequence of human ODC:

[0047] atgaacaactttggtaatgaagagtttgactgccacttcctcgatgaaggttttactgccaaggacattctggaccagaaaattaatgaagtttcttcttctgatgataaggatgccttctatgtggcagacctgggagacattctaaagaaacatctgaggtggttaaaagctctccctcgtgtcacccccttttatgcagtcaaatgtaatgatagcaaagccatcgtgaagacccttgctgctaccgggacaggatttgactgtgctagcaagactgaaatacagttggtgcagagtctgggggtgcctccagagaggattatctatgcaaatccttgtaaacaagtatctcaaattaagtatgctgctaataatggagtccagatgatgacttttgatagtgaagttgagttgatgaaagttgccagagcacatcccaaagcaaagttggttttgcggattgccactgatgatt...

Embodiment 2

[0064] The small molecule inhibitors involved are: 2,3-Dihydro-1H-perimidine-2-carbonitrile,

[0065] The structural formula is shown in the figure:

[0066]

Embodiment 3

[0068] The small molecule inhibitors involved are:

[0069] 4-[(2,3-Dihydro-1H-perimidin-2-ylimino)-methyl]-benzonitrole,

[0070] The structural formula is shown in the figure:

[0071]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biomedicine and relates to a small molecule inhibitor of ornithine decarboxylase (ODC) and an application thereof. A novel small molecule inhibitor aiming at ODC is found through computer-aided high-throughput medicine screening. Verification of the effects of the novel small molecule inhibitor finds that the novel small molecule inhibitor has good inhibiting effects on ODC and can be especially used for inhibiting human-derived ODC, preventing, treating and diagnosing tumor diseases and pathogenic microorganism infection and developing and preparing tumor medicines or medicines against pathogenic microorganism infection.

Description

technical field [0001] The invention relates to a small-molecule inhibitor of ornithine decarboxylase (Ornithine decarboxylase; ODC) and its application, in particular to a small-molecule inhibitor of human ornithine decarboxylase and its application in inhibiting and killing tumor cells. Background technique [0002] Protein is one of the main components of organisms and the main substance to complete various life activities. Among various proteins, proteases are crucial to life activities, and almost all biochemical reactions in organisms are catalyzed by proteases. The activity of various proteases in organisms has a strict regulation mechanism. Once there is a problem with the regulation mechanism, the activity of proteases is too high, too low or completely inactivated, which will cause various diseases. Therefore, it has very important theoretical and practical significance to regulate the activity of protease by drugs to restore and maintain it at a normal level. St...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K31/517A61P35/00A61P31/00
Inventor 王艳林刘森占景琼
Owner CHINA THREE GORGES UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com