Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

siRNA sequence for inhibiting survivin gene expression and use

A technology of gene expression and expression plasmid, applied in the field of biomedicine

Inactive Publication Date: 2015-04-22
JILIN UNIV
View PDF7 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] Malignant tumors are one of the main killers that threaten human life and health. Although various treatment methods continue to emerge, no truly effective cure method has been found so far. The treatment of the disease has always been a worldwide problem that has plagued the medical field for a long time.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • siRNA sequence for inhibiting survivin gene expression and use
  • siRNA sequence for inhibiting survivin gene expression and use
  • siRNA sequence for inhibiting survivin gene expression and use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1: Detection experiment of the silencing effect of chemically synthesized siRNA on survivin gene

[0027] 1. Main instruments, reagents and materials.

[0028] 1.1 Instruments: Nucleic acid synthesizer (GE Company), PCR instrument (ABI Company); real-time quantitative PCR instrument (Bio-Rad); cell incubator (Thermo), etc.

[0029] 1.2 Materials and reagents: RNAiMAXTM (invitrogen), DMEM medium (Gibco),

[0030] TurboCapture mRNA kit (QIAGEN), SensiMix TM one- Step Kit (Quantace), etc. Other biochemical reagents were purchased from Shanghai Sangon Bioengineering Technology Service Co., Ltd.

[0031] 1.3 PCR primers (synthesized by Biomaike Biotechnology Co., Ltd.):

[0032] survivin forward primer: 5'- AGAACTGGCCCTTCTTGGAGG -3'

[0033] survivin reverse primer: 5'- CTTTTTATGTTCCCTCTATGGGGTC -3'

[0034] GAPDH forward primer; 5'-GAAGGTGAAGGTCGGAGTC-3'

[0035] GAPDH reverse primer: 5'- GAAGATGGTGATGGGATTTC-3'

[0036] 2. Chemical synthesis of siRNA

...

Embodiment 2

[0047] Example 2: Effect of survivin gene silencing on tumor cell proliferation

[0048] Cells were packed into 5×10 3 Inoculate / well into a 96-well cell culture plate at 37°C, 5% CO 2 Cells were cultured in an incubator for 24 hours, transfected in DMEM medium containing 10% FBS without double antibody, according to the instructions of RNAiMAXTM, siRNA was added at 10, 20, 40 nM / well, and after incubation at 37°C for 48 hours, 20 μL was added to each well MTT (5mg / mL), continue to incubate at 37°C for 4h, remove the medium, add 200μL DMSO to dissolve formazan crystals, and measure the absorbance at 540nm.

[0049] The results of MTT assay for the inhibition of tumor cell proliferation by siRNA are shown in Table 1.

[0050] Table 1 The inhibitory rate of siRNA on tumor cell growth for 48 hours

[0051]

[0052] Since cell line A549, cell line Hela and cell line MCF-7 are lung cancer cell lines, cervical cancer cell lines and breast cancer cell lines respectively, the ...

Embodiment 3

[0053] Example 3: Western Blot detection of siRNA inhibition of survivin expression

[0054] The MDA-MB-231 cells, Hela cells and A549 cells were divided into 1.5×10 5 Inoculate / well into 6-well cell culture plates at 37°C, 5% CO 2 Cells were cultured in an incubator for 24 hours, transfected in DMEM medium containing 10% FBS without double antibody, according to the instructions of RNAiMAXTM, siRNA was added at 20 nM / well, incubated at 37°C for 48 hours, the medium was aspirated, and washed with PBS Twice, add 100 μL of cell lysate, lyse on ice for 10 minutes, scrape off the cells with a cell scraper, transfer to a 1.5ml centrifuge tube, centrifuge at 10,000 rpm for 5 minutes, and take the supernatant to determine the protein concentration. Take 30 μg of protein from each group for SDS-PAGE, transfer to PVDF membrane after electrophoresis, block and treat with primary antibody and secondary antibody, then perform chemiluminescent reaction and develop. see results figure...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a siRNA sequence for inhibiting survivin gene expression. The siRNA sequence has a broad spectrum siRNA antitumor effect, and has a good inhibitory effect on breast cancer, lung cancer, colon cancer, liver cancer, leukemia, gastric carcinoma, cervical cancer, oral epithelial carcinoma in vitro, and particularly on breast cancer, lung cancer and cervical cancer cells. When entering an organism through a certain manner, the siRNA double strand sequence can efficiently and specially inhibit the expression of related proteins of diseases to silence related disease protein, and can effectively remove the expression of target gene to achieve the purpose of treatment.

Description

technical field [0001] The invention discloses a double-strand siRNA molecule inhibiting the expression of survivin gene, and also provides the medical application of the siRNA molecule, which belongs to the technical field of biomedicine. Background technique [0002] Malignant tumors are currently one of the main killers threatening human life and health. Although various treatment methods continue to emerge, no truly effective radical cure has been found so far. The treatment of tumors has long been a worldwide problem that has plagued the medical community. Evasion of apoptosis is a hallmark of all tumors, allowing tumor cells to survive abnormal growth stimuli and resist chemotherapy and radiotherapy. The anti-apoptotic protein survivin has become a new and most potential therapeutic target to inhibit the growth of tumor cells by interacting with apoptosis signals. [0003] The phenomenon of RNA interference (RNAi) is an evolutionarily conserved defense mechanism again...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/63A61K48/00A61P35/00
Inventor 滕乐生谢晶李剑光李玉环逯家辉刘达李玉婧周毓麟郭志华
Owner JILIN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com