Immunoregulation peptide, and preparation method and application thereof
An immune regulation and antibacterial peptide technology, applied in the fields of medicine and bioengineering, can solve problems such as lack of research, and achieve high safety and the effect of strongly promoting the proliferation of T lymphocytes
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] 1. The polypeptide has the following sequence characteristics:
[0040] Amino acid sequence: GRVMPVLKSPTIPFFDPQIPK (SEQ ID NO: 1)
[0041] Nucleotide sequence:
[0042] GGCAGAGTGATGCCTGTCCTTAAATCTCCAACGATACCCTTTTTTGACCCTCAAATCCCAAAA (SEQ ID NO: 2)
[0043] It has isoelectric point (pI): 9.99, molecular weight (Mw): 2367.88.
[0044] 2. After chemically synthesizing the peptide, the MTT experiment found that the peptide has a strong effect of promoting T lymphocyte proliferation (see figure 1 ).
[0045] use T lymphocyte separation reagent (ONE LAMBDA, US) was used to separate human blood T lymphocytes, and RPMI 1640 (containing 10% FCS, 100U / ml penicillin / streptomycin) culture medium was used to adjust the cell concentration to about 4×10 6 pieces / ml. The effect of the chemically synthesized immunomodulatory peptide (chemically synthesized peptide) on the proliferation of T lymphocytes was detected by the traditional MTT method. Add 50 μl of cells and 150 μl of ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com