Antigen for detecting porcine epidemic diarrhea virus neutralizing antibody and its preparation method and application
A porcine epidemic diarrhea and antigen technology, applied in the field of genetic engineering, can solve problems such as biological safety hazards, and achieve the effects of easy follow-up pilot test and expanded production, large output, and easy commercialization
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] 1. Amplification of PEDV S1 and partial S2 gene segmented recombinant genes
[0039] (1) Partial S gene segmentation strategy of PEDV and its synthesis
[0040] According to the prediction of the S protein signal peptide by the software, the signal peptide needs to be removed when segmented expression. According to the principle of differential segmentation of identified antigen regions of PEDV, the PEDVS1 and part of the S2 gene are divided into 7 segments, which are named SP1-SP7 respectively. The nucleotide sequences of the SP1-SP7 are shown in SEQ ID NO: 1-7, respectively. The amino acid sequences of SP1-SP7 are shown in SEQ ID NO: 8-14 respectively (see Table 1). At the same time, SP5-SP7 also serves as a complementary interface. The above seven fragments all added a His tag gene at the 3' end.
[0041] Table 1 Nucleotide sequence and amino acid sequence of SP1-SP7
[0042]
[0043] (2) PEDV RNA extraction and RT-PCR
[0044] The extraction of PEDV RNA was ...
Embodiment 2
[0096] 1. Amplification of the SP4 gene
[0097] The content of this part is basically the same as that of Example 1, only the SP4-specific primers are different. The restriction sites of the upstream and downstream primers of SP4 in Example 1 were exchanged to obtain SP4F' and SP4R' in this example to meet the requirements of the downstream restriction sites of the eukaryotic expression plasmid pFastBacDualp10 promoter. The sequence of the SP4F' is: GCCTCGAGATGAGTATTAGGACAGAATATTTACAGCTT, and the sequence of the SP4R' is: GCGGTACCACTATACATATGAAGCTTCTCAGCGTC.
[0098] 2. Construction of eukaryotic expression plasmid expressing SP4 gene and synthesis of recombinant protein in insect cell sf9
[0099] (1) Construction of a recombinant plasmid expressing the SP4 gene
[0100]For the eukaryotic expression plasmid pFastBacDual (Invitrogen) digestion, ligation, and large-scale preparation of recombinant plasmids, see the process of prokaryotic expression vector construction in Exa...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap