Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer pair and probe for detecting avian influenza virus in sample by fluorescence RT-PCR and kit containing primer pair and probe

A technology for RT-PCR and avian influenza virus, applied in the field of kits containing the primer and probe sequences, can solve the problems of unsuitable virus early diagnosis, PCR product contamination, non-specific amplification, etc., and shorten the detection cycle , high-throughput detection, and good specificity

Active Publication Date: 2014-12-10
JIANKANGYUAN PHARMA GROUP
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The current common virus isolation and serological diagnosis methods are cumbersome, time-consuming, low sensitivity, and poor specificity, and are not suitable for early diagnosis of viruses
With the development of molecular biology technology, ordinary PCR method has been widely used in clinical diagnosis, but this technology requires post-processing of PCR products, which can easily lead to contamination of PCR products and a certain degree of non-specific amplification.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer pair and probe for detecting avian influenza virus in sample by fluorescence RT-PCR and kit containing primer pair and probe
  • Primer pair and probe for detecting avian influenza virus in sample by fluorescence RT-PCR and kit containing primer pair and probe
  • Primer pair and probe for detecting avian influenza virus in sample by fluorescence RT-PCR and kit containing primer pair and probe

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] Example 1 Primer and probe design, establishment and optimization of reaction system

[0061] 1. Primer and probe design:

[0062] Through comparative analysis of all known avian influenza virus H7 (including H7N9) genome sequences, select highly conserved segments with no secondary structure, and design multiple pairs of primers and probes. The length of the primers is generally 20 bases Left and right, there is no complementary sequence between and within the primers. The optimal primer and probe sequence combinations are as follows:

[0063] Upstream primer H7N9-4.0-F: GGTTTAGCTTCGGGGCATC

[0064] Downstream primer H7N9-4.0-R: TATATACAAATAGTGCACCGCATGT

[0065] Probe H7N9-4.0-B: TTATGCAAATGAAAACCAATCCCATTG

[0066] 2. Establishment and optimization of the reaction system:

[0067] The target region template is obtained by the following method: use the inactivated H7 strain of avian influenza virus (including H7N9, provided by China Institute for the Control of...

Embodiment 2

[0082] Example 2 Sensitivity experiment for detecting the copy number of H7N9 subtype influenza virus

[0083] Set the concentration to 10 6 copies / ml of the H7N9 inactivated strain provided by China Biological Products Inspection Institute, diluted to 10 by 10 times 5 copies / ml, 10 4 copies / ml, 10 3 copies / ml, 10 2 copies / ml, using the primers, probes, and established reaction systems, instruments, and amplification conditions designed in steps 1-4 in Example 1, to carry out fluorescent RT-PCR detection.

[0084] The results showed that in 10 3 copies / ml, the CT value is 25, and other indicators also meet the detection requirements. Therefore, the present invention improves the sensitivity of detection by optimizing primers and probes, and its sensitivity can reach 10 3 copies / ml. see results figure 1 .

Embodiment 3

[0085] Example 3 A Specific Experiment for Detecting H7N9 Subtype Influenza Virus

[0086] This experimental example proves that the reagents or kits provided by the present invention can detect viruses in various positive samples under established conditions, and negative samples have no detection results.

[0087] 1. Sample:

[0088] 120 samples were tested, including 31 positive samples determined by the method recommended by the Chinese Center for Disease Control and Prevention to be positive for avian influenza virus H7N9; the other 89 were negative samples. These 120 samples were throat swabs. Sample processing: Add 500 μl of PBS or saline to the centrifuge tube containing the swab, shake vigorously for 30 sec. Squeeze out the liquid as much as possible and move it to a centrifuge tube for 20 sec at 6000rpm, and take the supernatant for later use.

[0089] Negative control: DEPC water;

[0090] Positive control: H7N9 inactivated strain, provided by China Institute ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a primer and a probe sequence for detecting avian influenza virus, especially the nucleotide fragment of type H7 (including H7N9) and a kit containing the primer and the probe sequence. The primer and the probe sequence provided by the invention can be used to realize high-sensitivity and high-specificity detection of avian influenza virus, especially type H7 (including H7N9).

Description

technical field [0001] The invention relates to a primer and a probe sequence for detecting avian influenza virus, especially the H7 type nucleotide fragment, and a kit containing the primer and probe sequence. Background technique [0002] Avian influenza mainly refers to an infectious disease caused by influenza virus that is prevalent in poultry. Since the outbreak in Shanghai and Anhui in March 2013, as of April 21, 2013, a total of 102 cases of avian influenza H7N9 have been reported in my country, of which 20 died, 12 recovered, and the remaining 70 are in designated places Medical units received treatment, involving Shanghai, Jiangsu, Anhui, Zhejiang and other provinces and cities. In response to the continuous spread of the epidemic, the National Health and Family Planning Commission quickly issued a diagnosis and treatment plan for human infection with H7N9 avian influenza. The hazards of the epidemic. [0003] The latest comparative study found that the genetic d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11
Inventor 卫明邱庆丰陈勉乔张宏斌苏祖妙
Owner JIANKANGYUAN PHARMA GROUP
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com