Salt resistance related protein IbEST of sweet potato and coding gene and application thereof

A technology related to protein and protein, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve problems affecting food production and restrictions, and achieve the effect of broad application space and market prospects

Inactive Publication Date: 2013-07-17
CHINA AGRI UNIV
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The existence of large areas of salinized land has seriously affected food production and has become the main factor restricting agricultural production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Salt resistance related protein IbEST of sweet potato and coding gene and application thereof
  • Salt resistance related protein IbEST of sweet potato and coding gene and application thereof
  • Salt resistance related protein IbEST of sweet potato and coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1. Obtaining the protein IbEST and its coding gene related to salt tolerance of sweet potato

[0046] 1. Obtaining the protein IbEST and its coding genes related to salt tolerance

[0047] Experimental material: Sweet potato salt-tolerant mutant LM79 (the public can obtain it from China Agricultural University. The non-patent document that records this material is: He Shaozhen. In vitro screening of sweet potato salt-tolerant mutants and cloning of salt-tolerant candidate genes. China Agricultural University Doctoral dissertation, 2008;) The unfolded leaves of the sterile seedlings were removed, and the leaves were quick-frozen in liquid nitrogen and stored at -80°C.

[0048] 1. Extraction and purification of total RNA from leaves

[0049] Take about 2g of the unfolded leaves of the LM79 sterile seedlings, grind them into powder in liquid nitrogen, add them to a 10mL centrifuge tube, and use the Applygen Plant RNA Extraction Kit (Applygen Technologies Inc, Beijing) to e...

Embodiment 2

[0073] Example 2. Application of IbEST protein in improving plant salt tolerance

[0074] 1. Obtaining tobacco transfer to IbEST

[0075] 1. Construction of recombinant vector pCBIbEST

[0076] According to the coding sequence of the sweet potato IbEST protein cDNA, a primer sequence was designed to amplify the complete coding sequence. The forward and reverse primers were introduced into the BamH I and Sac I restriction sites respectively. The primer sequences are as follows:

[0077] Primer 11: 5' GGATCC ATGAAAGGCGTCTTCTCGG’ (sequence 5) (the underlined part is the BamH I restriction site),

[0078] Primer 12: 5’ GAGCTC CTATACTAAGTTTCTAAATTCCAAGCAA3' (sequence 6) (the underlined part is the Sac I restriction site).

[0079] Take the DNA molecule shown in sequence 1 in the artificially synthesized sequence table as a template (or use LM79cDNA as a template), use primer 11 and primer 12 for PCR amplification to obtain a 1245 bp PCR product, which is ligated to the pGEM-TEasy vector ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a salt resistance related protein IbEST of a sweet potato and a coding gene thereof and application thereof. The protein related to salt resistance of the sweet potato provided by the invention is named IbEST, comes from Ipomoea batatas and is shown in (a) or (b) below: (a) the protein composed of amino acid sequences shown as a sequence 2 in a sequence list; and (b) the protein derived by the sequence 2 by replacing, deleting and / or adding residual acids of one or multiple amino acids in the amino acid sequence as shown by the sequence 2 in the sequence list and related to the stress tolerance of a plant. The experiment proves that the IbEST gene and the coding protein play an important role in the process of withstanding abiotic stress by the plant. The IbEST protein and coding gene provided by the invention have an important application value in the research of improving the salt tolerance of the plant. The salt resistance related protein IbEST of the sweet potato and coding gene have wide application space and market foreground in the agricultural field.

Description

Technical field [0001] The invention relates to the field of biotechnology, in particular to a sweet potato salt tolerance related protein IbEST and its coding gene and application. Background technique [0002] There are large areas of salinized land in the world. According to statistics, there are 3.8×10 8 hm 2 Saline-alkali land. In irrigated areas, there are secondary salinized land that accounts for 33% of the arable land. Soil salinization seriously affects the development of modern agriculture. As far as my country is concerned, nearly one tenth of the country’s 1.8 billion mu of arable land is secondary salinized land, and there are also 2×10 7 hm 2 Saline wasteland. The existence of large areas of salinized land has severely affected food production and has become the main factor restricting agricultural production. Through in-depth research on the mechanism of plant salt tolerance, cultivating new varieties of salt-tolerant crops is one of the most economical and effe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07K14/415C12N15/29C12N15/82C12N15/11C12N5/10C12N1/15C12N1/19C12N1/21A01H5/00
Inventor 刘庆昌翟红何绍贞王连军刘德高
Owner CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products