Anti-anthracnose molecular diagnostic kit for pod bean and application thereof

An anti-anthracnose and molecular diagnosis technology, which is applied in the direction of DNA/RNA fragments, microbial determination/inspection, recombinant DNA technology, etc., to achieve the effects of shortening the time of seed selection, saving production costs, and saving land

Active Publication Date: 2014-07-02
TIANJIN RES INST OF VEGETABLE
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In my country, there is no report on the research on the use of molecular marker-assisted breeding to breed beans for resistance to anthracnose

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-anthracnose molecular diagnostic kit for pod bean and application thereof
  • Anti-anthracnose molecular diagnostic kit for pod bean and application thereof
  • Anti-anthracnose molecular diagnostic kit for pod bean and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] The detection method is carried out by using known anthracnose-resistant and anthracnose-susceptible bean plants, comprising the following steps:

[0039] (1) Extract genomic DNA from anthracnose-resistant and susceptible kidney beans: Take 100 mg of young kidney bean leaves, cut them into pieces with scissors, place them in a tissue grinder, add 100 μL of extraction buffer solution (1% SDS, 10 mmol / L Tris, 0.3 mol / L EDTA, 1% PVP, pH8.0), fully ground into a homogenate, then add 400μL extraction buffer solution, mix well and incubate in a 90°C water bath for 20 minutes, shake it upside down from time to time, take it out and place Store in an ice bath for 5 minutes at 4°C for later use.

[0040] (2) Determination of DNA concentration: Two methods can be used, one is to measure by ultraviolet spectrophotometer, and the other is to measure by using a self-made known standard gel plate. The general concentration is required to be above 200ng / μL.

[0041] (3) PCR amplific...

Embodiment 2

[0045] The kit for molecular diagnosis of anti-anthracnose in bean pod is characterized in that it is composed of specific primer 1: GGATCCATGCAAGGAACCTCCAAAGAC; specific primer 2: ATTACTTGTGGAATTTTCCATGAGTCGACA; dNTP, Taq polymerase, PCR buffer, DNA template, sterile Composition of ionized water, 6× loading buffer, TBE electrophoresis buffer and standard positive marker: 2.0 μl of 10×PCR buffer solution, 0.2 μl of 10mmol / L dNTP, 1 μl of 10 μmol / L specific primer 1 and 2 , Genomic DNA 400ng of kidney bean, 2 units of Taq polymerase, and sterile water to make up to 25 microliters, put the thin-walled centrifuge tube specially for PCR filled with the above liquid into the PCR amplification instrument, and the amplification conditions are: denaturation at 95°C at 120 Seconds, followed by denaturation at 95°C for 30 seconds, annealing at 55°C for 60 seconds, extension at 70°C for 120 seconds, the number of cycles is 40, and finally extension at 70°C for 480 seconds, the amplificati...

Embodiment 3

[0048] Comparative test:

[0049] The invention is a key method for breeding new varieties of bean for pods resistant to anthracnose. The new bean variety selected and bred by the present invention is an anthracnose-resistant variety that aggregates resistance genes and comprehensive excellent traits. If a disease-resistant variety is used in production, under conditions suitable for the onset of the disease, the bean will not develop disease, and spraying of chemical agents is no longer necessary. potion. Not only the production cost is saved, but also the environmental pollution caused by pesticide residues is reduced. The following comparative experiments are used to further illustrate:

[0050] Table 1: Comparison of artificial seedling inoculation identification and molecular diagnostic kits

[0051]

[0052] Final conclusion: the present invention is similar to the conventional "artificial seedling inoculation identification" in that it is necessary to prepare ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses an anti-anthracnose molecular diagnostic kit for a pod bean, which is characterized by consisting of a specific primer 1 of GGATCCATGCAAGGAACCTCCAAAGAC, a specific primer 2 of ATTACTTGTGGAATTTTCCATGAGTCGACA, dNTP, a Tag polymerase, a PCR (Polymerase Chain Reaction) buffer solution, a DNA template, a sterile deionized water, a 6x upper sample buffer solution, a TBE (Tetrabromoethane) electrophoretic buffer solution and a standard positive marker. The consistency of the detection result of the kit disclosed by the invention to the field is as high as 96%; the detection repeatability is as high as 100%; the specificity is as high as 100%, simultaneously the kit has the characteristics of being simple, convenient, quick, accurate,and not influenced by season of growth, environmental conditions and the like; detection can be performed in a lab, so a great quantity of land, labor and materials are saved; the breeding time is shortened, and the kit has important application value in bean breeding.

Description

technical field [0001] The invention relates to a kit for molecular marker-assisted early screening of anthracnose-resistant bean germplasm resources and new varieties in biotechnology and a detection method using the kit. Background technique [0002] Bean anthracnose is caused by Bacillus anthracnose [ Colletotrichum lindemuthianum (Sacc. et Magn.) Br. et Cav.] is a fungal disease caused by bean leaves, stems and pods. Once the diseased varieties are infected, the production will be reduced by 20%-30%; when the temperature and humidity are suitable, the production reduction will even reach 100%. In addition, the disease is also very common in the field of bean seed propagation, and the phenomenon of seed contamination is serious. Seeds with pathogenic bacteria are used in the production of bean planting bases, resulting in a vicious circle of anthracnose. According to reports, areas where anthrax has occurred include Beijing, Tianjin, Hebei, Inner Mongolia, Shanxi, Liao...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11
Inventor 古瑜韩启厚
Owner TIANJIN RES INST OF VEGETABLE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap