Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

N-(3-oxo-dodecanoyl)-L-homoserine lactone aptamer, its screening method and application

A serine lactone, dodecanoyl technology, applied in DNA/RNA fragments, gene therapy, pharmaceutical formulations, etc., can solve the problems of time-consuming, allergic reaction, loss, etc., achieve the best clinical treatment application prospects, simple production process, The effect of stable physical and chemical properties

Inactive Publication Date: 2014-03-12
GUANGDONG MEDICAL UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, although this type of antibody has potential value in the treatment of Pseudomonas aeruginosa infection, since the mouse-derived antibody is a foreign protein to humans, if the mouse-derived monoclonal antibody of OdDHL is directly applied to the human body , the human body can produce antibodies against mouse antibodies (human anti-mouse reaction), which can bind to antibodies and remove mouse antibodies, reducing its efficacy
Moreover, direct application of murine antibodies may also induce allergic reactions and cause damage to patients
Therefore, the mouse-derived antibody needs to be humanized before it can be applied to the human body. However, the humanized transformation of the mouse-derived antibody is a complicated and time-consuming process, which requires high technical requirements and is easy to implement during the transformation process. This leads to a decrease in antibody affinity, or even complete loss, which leads to the gradual abandonment of the development of murine antibodies for therapeutic use

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • N-(3-oxo-dodecanoyl)-L-homoserine lactone aptamer, its screening method and application
  • N-(3-oxo-dodecanoyl)-L-homoserine lactone aptamer, its screening method and application
  • N-(3-oxo-dodecanoyl)-L-homoserine lactone aptamer, its screening method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Example 1 Nucleic acid aptamer

[0054] aptamer The nucleotide sequence is:

[0055] GCAATGGTACGGTACTTCCACCTTGAGAGCTGTCTGATCTGTACACGCCCTTTTACATGCTCATCCAAAAGTGCACGCTACTTTGCTAA (SEQ ID NO: 1).

Embodiment 2

[0056] Example 2 Nucleic acid aptamer screening method

[0057] 1. Main reagents and buffers:

[0058] (1) Main reagents:

[0059] 1. OdDHL analogs (OdDHL surrogates, OdDHLS )

[0060] The OdDHLS selected in the present invention is: 7-oxo-7-[[(3S)-2-oxo-3-pyrrolidinyl] amino]-Heptanoic acid, which was synthesized by Shanghai Kesheng Pharmaceutical Research and Development Co., Ltd.

[0061] Chemical formulas of OdDHL and OdDHLS:

[0062]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
affinityaaaaaaaaaa
Login to View More

Abstract

The invention relates to the field of biotechnologies, in particular to an N-(3-oxo-dodecanoyl)-L-homoserine lactone (OdDHL) aptamer, its screening method and application. The aptamer provided in the invention can have high affinity and high specificity binding with OdDHL, thus having a quorum sensing system interfering with Pseudomonas aeruginosa and inhibiting the expression potential of Pseudomonas aeruginosa virulence genes. The aptamer provided in the invention can bind with OdDHL by an affinity equal to that between an antibody and OdDHL, and its preparation process is simpler and is easier to operate, and the cost is lower.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a nucleic acid aptamer capable of high affinity and specific binding to N-(3-lauroyl)-L-homoserine lactone screened by molecular biology techniques and Its screening methods and applications. Background technique [0002] Pseudomonas aeruginosa ( Pseudomonase aeruginosa , PA) is an opportunistic infectious pathogen, which has strong resistance to most of the clinically used antibiotics, and the development of drug resistance is very fast, and it is very easy to develop resistance to new antibiotics sex. [0003] Studies have shown that various severe infections caused by Pseudomonas aeruginosa are closely related to the release of its virulence factors, and the expression of most of the virulence factors of Pseudomonas aeruginosa is controlled by its quorum sensing (QS) system. positive regulation. N-(3-oxydodecanoyl)-L-homoserine lactone (N-(3-oxo-dodecanoyl)-l-homoserine lacton...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/115C12N15/10A61K48/00A61P31/04
Inventor 赵祖国刘仿喻云梅李国明张腊喜米娜许壁榆晏双双
Owner GUANGDONG MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com