Actinobacillus pleuropneumoniae LAMP kit and application method thereof
A technology for pleuropneumonia and actinobacillus, applied in the field of veterinary biological products, can solve the problems of time-consuming and expensive equipment, and achieve the effects of short reaction time, simple operation and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0024] The present invention will be described in detail below in conjunction with specific embodiments.
[0025] 1. Search for specific gene sequences
[0026]Landed at the National Center for Biotechnology (NCBI) in the United States, and retrieved the disulfide bound formation protein E (dsbE) protein gene sequence (AF458418, AF458420, AF458421, AF458422, AF458423, AF458425, AF458426, AF458427, AF458428, AF458429, AF458430, AF458431, AF458432, AF458433), and then compared by Blast and AlignX software to find out the highly conserved regions in 1-14 sera. The specific sequence found is as follows: TACCTTTATTATTGTTGATT GCACTGGTAG CGTTTTTAAC CGTGCCGTTA ATGAATAAGG ATGCCCTTTC GCTGACCGAAGATTGGCGAG ATAAACCTTT TCCGGAATTT GTCGGTAAAA ATTTACTCGA TCATAATGCG CATATTAATAATAACAGTTT GCCGAAAGAG CCTTATATTT TGTAACGTAATTG GGCAAGTTGGG
[0027] 2. Design of LAMP primers
[0028] Log on to the webpage https: / / primerexplorer.jp / e / , and design the primers involved in the present invention through ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com