Actinobacillus pleuropneumoniae LAMP kit and application method thereof
A technique for pleuropneumoniae and actinobacillus is applied in the field of veterinary biological products, which can solve the problems of long time and expensive equipment, and achieve the effects of short reaction time, simple operation and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0024] The present invention will be described in detail below in conjunction with specific embodiments.
[0025] 1. Search for specific gene sequences
[0026]Landed at the National Center for Biotechnology (NCBI) in the United States, and retrieved the disulfide bound formation protein E (dsbE) protein gene sequence (AF458418, AF458420, AF458421, AF458422, AF458423, AF458425, AF458426, AF458427, AF458428, AF458429, AF458430, AF458431, AF458432, AF458433), and then compared by Blast and AlignX software to find out the highly conserved regions in 1-14 sera. The specific sequence found is as follows: TACCTTTATTATTGTTGATT GCACTGGTAG CGTTTTTAAC CGTGCCGTTA ATGAATAAGG ATGCCCTTTC GCTGACCGAAGATTGGCGAG ATAAACCTTT TCCGGAATTT GTCGGTAAAA ATTTACTCGA TCATAATGCG CATATTAATAATAACAGTTT GCCGAAAGAG CCTTATATTT TGTAACGTAATTG GGCAAGTTGGG
[0027] 2. Design of LAMP primers
[0028] Log on to the webpage https: / / primerexplorer.jp / e / , and design the primers involved in the present invention through ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com